Transcript: Mouse XM_006500833.3

PREDICTED: Mus musculus calcium/calmodulin-dependent protein kinase II, delta (Camk2d), transcript variant X21, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Camk2d (108058)
Length:
4957
CDS:
1087..2274

Additional Resources:

NCBI RefSeq record:
XM_006500833.3
NBCI Gene record:
Camk2d (108058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500833.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012481 GCATAGACTGTATCAGCAGAT pLKO.1 1743 CDS 100% 4.050 5.670 N Camk2d n/a
2 TRCN0000280223 GCATAGACTGTATCAGCAGAT pLKO_005 1743 CDS 100% 4.050 5.670 N Camk2d n/a
3 TRCN0000012479 GCGTAAAGATCCTTATGGAAA pLKO.1 1644 CDS 100% 4.950 3.960 N Camk2d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500833.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05930 pDONR223 100% 71.9% 67.5% None (many diffs) n/a
2 ccsbBroad304_05930 pLX_304 0% 71.9% 67.5% V5 (many diffs) n/a
3 TRCN0000481368 TGGGGGTCGACGCTCATAGTTAAT pLX_317 29.9% 71.9% 67.5% V5 (many diffs) n/a
4 ccsbBroadEn_14565 pDONR223 0% 71.9% 67.5% None (many diffs) n/a
5 ccsbBroad304_14565 pLX_304 0% 71.9% 67.5% V5 (many diffs) n/a
6 TRCN0000481152 TAATACCTAGCTTTCCAGTGCCAA pLX_317 31.4% 71.9% 67.5% V5 (many diffs) n/a
Download CSV