Transcript: Mouse XM_006501086.3

PREDICTED: Mus musculus mucolipin 3 (Mcoln3), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mcoln3 (171166)
Length:
1697
CDS:
226..1632

Additional Resources:

NCBI RefSeq record:
XM_006501086.3
NBCI Gene record:
Mcoln3 (171166)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501086.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102905 GCGAAGTACAATCTCCTTATT pLKO.1 1156 CDS 100% 13.200 18.480 N Mcoln3 n/a
2 TRCN0000102907 CGCTGATAAACGGAGACGATA pLKO.1 1328 CDS 100% 4.950 6.930 N Mcoln3 n/a
3 TRCN0000102908 GACTATAACATTCGACAACAA pLKO.1 699 CDS 100% 4.950 6.930 N Mcoln3 n/a
4 TRCN0000102906 GCTGACTATAACATTCGACAA pLKO.1 696 CDS 100% 4.050 5.670 N Mcoln3 n/a
5 TRCN0000102909 GCTATGATCTATCTAGGCTAT pLKO.1 1228 CDS 100% 4.050 2.835 N Mcoln3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501086.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12197 pDONR223 100% 36% 37.7% None (many diffs) n/a
2 ccsbBroad304_12197 pLX_304 0% 36% 37.7% V5 (many diffs) n/a
3 TRCN0000478835 GCCATGTGATAGAGAATTGTTCGG pLX_317 45.7% 36% 37.7% V5 (many diffs) n/a
Download CSV