Transcript: Mouse XM_006501198.3

PREDICTED: Mus musculus sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C (Sema6c), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sema6c (20360)
Length:
4086
CDS:
458..3349

Additional Resources:

NCBI RefSeq record:
XM_006501198.3
NBCI Gene record:
Sema6c (20360)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340115 CACTCCGTTCTGCAAAGTATG pLKO_005 1089 CDS 100% 10.800 15.120 N Sema6c n/a
2 TRCN0000112265 CCGGGTATGTAAACGTGACAT pLKO.1 1237 CDS 100% 4.950 6.930 N Sema6c n/a
3 TRCN0000112269 CTTTCCTGGATGTATCGTCTA pLKO.1 1978 CDS 100% 4.050 5.670 N Sema6c n/a
4 TRCN0000112268 GCCACACTTTGTCTATGCGTT pLKO.1 1129 CDS 100% 2.640 3.696 N Sema6c n/a
5 TRCN0000340043 GACATGGAGGAGTCAAGATAT pLKO_005 763 CDS 100% 13.200 9.240 N Sema6c n/a
6 TRCN0000112267 GCCTTCTACCTAGATGATATT pLKO.1 1457 CDS 100% 13.200 9.240 N Sema6c n/a
7 TRCN0000340113 TCCAGAGGCTGCATGAGTATC pLKO_005 2084 CDS 100% 10.800 7.560 N Sema6c n/a
8 TRCN0000112266 GCGCCTTCTACCTAGATGATA pLKO.1 1455 CDS 100% 5.625 3.938 N Sema6c n/a
9 TRCN0000340112 CTTCTTGCCTGTGGAACAAAT pLKO_005 866 CDS 100% 13.200 7.920 N Sema6c n/a
10 TRCN0000340044 CCTTCTACTTTGACGTCTTAC pLKO_005 1341 CDS 100% 10.800 6.480 N Sema6c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11509 pDONR223 100% 42.8% 39.3% None (many diffs) n/a
2 ccsbBroad304_11509 pLX_304 0% 42.8% 39.3% V5 (many diffs) n/a
3 TRCN0000481611 ACGCTCACTTGGTATTACATGAGA pLX_317 27.6% 42.8% 39.3% V5 (many diffs) n/a
Download CSV