Transcript: Mouse XM_006501243.2

PREDICTED: Mus musculus adaptor-related protein complex 1 associated regulatory protein (Ap1ar), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ap1ar (211556)
Length:
2484
CDS:
26..1000

Additional Resources:

NCBI RefSeq record:
XM_006501243.2
NBCI Gene record:
Ap1ar (211556)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248972 ACAAATTATGTTAGCGTATTG pLKO_005 1893 3UTR 100% 10.800 15.120 N Ap1ar n/a
2 TRCN0000257852 CCTTTCACATGCCATTATATT pLKO_005 1646 3UTR 100% 15.000 10.500 N Ap1ar n/a
3 TRCN0000248969 GCAAGAGATGACAGGATTAAA pLKO_005 1545 3UTR 100% 15.000 10.500 N Ap1ar n/a
4 TRCN0000248971 GGATACTTTGAGTTGGTAATA pLKO_005 1582 3UTR 100% 13.200 9.240 N Ap1ar n/a
5 TRCN0000248970 CGACCTGTGTCTGAGTCTTAG pLKO_005 1915 3UTR 100% 10.800 7.560 N Ap1ar n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1484 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08533 pDONR223 100% 66.6% 64.2% None (many diffs) n/a
2 ccsbBroad304_08533 pLX_304 0% 66.6% 64.2% V5 (many diffs) n/a
3 TRCN0000466991 CCCTGTGGATACATCTAACCATGC pLX_317 59.3% 66.6% 64.2% V5 (many diffs) n/a
Download CSV