Transcript: Mouse XM_006501731.1

PREDICTED: Mus musculus polypyrimidine tract binding protein 2 (Ptbp2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptbp2 (56195)
Length:
3791
CDS:
591..2204

Additional Resources:

NCBI RefSeq record:
XM_006501731.1
NBCI Gene record:
Ptbp2 (56195)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109232 CCAACCAATTTACATCCAGTA pLKO.1 959 CDS 100% 4.050 5.670 N Ptbp2 n/a
2 TRCN0000375551 CCAGTATGGTGATCCGGTAAA pLKO_005 1259 CDS 100% 10.800 8.640 N Ptbp2 n/a
3 TRCN0000109231 GCTGTACCCTAAGGATTGATT pLKO.1 1330 CDS 100% 5.625 4.500 N Ptbp2 n/a
4 TRCN0000317485 GCTGTACCCTAAGGATTGATT pLKO_005 1330 CDS 100% 5.625 4.500 N Ptbp2 n/a
5 TRCN0000419376 CCTGTTGGTTAGCAATTTAAA pLKO_005 1622 CDS 100% 15.000 10.500 N PTBP2 n/a
6 TRCN0000418376 GCAGCTATTACTATGGTTAAT pLKO_005 906 CDS 100% 13.200 9.240 N PTBP2 n/a
7 TRCN0000109233 GCTCGCCATGAATCATCTTAA pLKO.1 1772 CDS 100% 13.200 9.240 N Ptbp2 n/a
8 TRCN0000418847 GTTTACCCTCTTCGGTGTTTA pLKO_005 1670 CDS 100% 13.200 9.240 N PTBP2 n/a
9 TRCN0000422912 AGCCCAGAGTCCAGTACTTAG pLKO_005 1115 CDS 100% 10.800 7.560 N PTBP2 n/a
10 TRCN0000001109 CTGTTATCATTCCTTGGTTAT pLKO.1 2301 3UTR 100% 10.800 7.560 N PTBP2 n/a
11 TRCN0000375550 TATGAGTGGCATGGTAGTTAC pLKO_005 683 CDS 100% 10.800 7.560 N Ptbp2 n/a
12 TRCN0000109230 GCTGTTATCATTCCTTGGTTA pLKO.1 2300 3UTR 100% 4.950 3.465 N Ptbp2 n/a
13 TRCN0000109234 CCTGCGTTAGACCCAGCCATT pLKO.1 1440 CDS 100% 1.350 0.945 N Ptbp2 n/a
14 TRCN0000001112 CATCTTCGTAACCAACCAATA pLKO.1 948 CDS 100% 10.800 15.120 N PTBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14237 pDONR223 100% 92.9% 98.6% None (many diffs) n/a
2 ccsbBroad304_14237 pLX_304 0% 92.9% 98.6% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000473640 AAGAATCTGTTACTACTTCAAATT pLX_317 32.9% 92.9% 98.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV