Transcript: Mouse XM_006502081.2

PREDICTED: Mus musculus pre-mRNA processing factor 3 (Prpf3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prpf3 (70767)
Length:
3458
CDS:
1608..3254

Additional Resources:

NCBI RefSeq record:
XM_006502081.2
NBCI Gene record:
Prpf3 (70767)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502081.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328847 GTGTATAGAGTTCGAAATTTG pLKO_005 2835 CDS 100% 13.200 18.480 N Prpf3 n/a
2 TRCN0000328788 TCTCATGCTACATCGGATAAA pLKO_005 2990 CDS 100% 13.200 18.480 N Prpf3 n/a
3 TRCN0000109229 CGACAAATCGAGGAACGGAAA pLKO.1 1653 CDS 100% 4.050 5.670 N Prpf3 n/a
4 TRCN0000109228 CGTCTCATGCTACATCGGATA pLKO.1 2988 CDS 100% 4.050 5.670 N Prpf3 n/a
5 TRCN0000328844 ACTACTGTTAGCCCTTGTATC pLKO_005 3256 3UTR 100% 10.800 8.640 N Prpf3 n/a
6 TRCN0000328848 TTACGGACAAAGGCTCAATTG pLKO_005 2226 CDS 100% 10.800 8.640 N Prpf3 n/a
7 TRCN0000294112 TTCCATGACAAGGGCAAATTT pLKO_005 2187 CDS 100% 15.000 10.500 N PRPF3 n/a
8 TRCN0000328789 TCCATGACAAGGGCAAATTTG pLKO_005 2188 CDS 100% 13.200 9.240 N Prpf3 n/a
9 TRCN0000109227 GCCCAAAGTGAGAATCTCAAA pLKO.1 2621 CDS 100% 4.950 3.465 N Prpf3 n/a
10 TRCN0000109225 CCTTGTATCTTCTTTGCCTTT pLKO.1 3268 3UTR 100% 4.050 2.835 N Prpf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502081.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02088 pDONR223 100% 74% 79.7% None (many diffs) n/a
2 ccsbBroad304_02088 pLX_304 0% 74% 79.7% V5 (many diffs) n/a
3 TRCN0000467879 TATACCCTGATCCCCTGATACGTG pLX_317 17.9% 74% 79.7% V5 (many diffs) n/a
Download CSV