Transcript: Mouse XM_006502212.3

PREDICTED: Mus musculus family with sequence similarity 46, member C (Fam46c), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam46c (74645)
Length:
5452
CDS:
71..1246

Additional Resources:

NCBI RefSeq record:
XM_006502212.3
NBCI Gene record:
Fam46c (74645)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502212.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268032 CATTGCGCACCCTCCAATTAC pLKO_005 1186 CDS 100% 13.200 18.480 N Fam46c n/a
2 TRCN0000268075 AGTACGACTACCTCATGATTC pLKO_005 978 CDS 100% 10.800 15.120 N Fam46c n/a
3 TRCN0000434135 ACTTTCCAACCTTGGAGATAA pLKO_005 189 CDS 100% 13.200 9.240 N TENT5C n/a
4 TRCN0000268031 TTCTGCCAGAGGGCGTGAATA pLKO_005 426 CDS 100% 13.200 9.240 N Fam46c n/a
5 TRCN0000268030 AGCTGAGTTCTCGGTAGATTC pLKO_005 1605 3UTR 100% 10.800 7.560 N Fam46c n/a
6 TRCN0000283586 CAATCCCATCTCCGAGCATTT pLKO_005 667 CDS 100% 10.800 7.560 N Fam46c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502212.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15873 pDONR223 0% 89.9% 95.9% None (many diffs) n/a
2 ccsbBroad304_15873 pLX_304 0% 89.9% 95.9% V5 (many diffs) n/a
3 TRCN0000480531 GACTCCGATGACCGGCAACATGAA pLX_317 30.2% 89.9% 95.9% V5 (many diffs) n/a
4 ccsbBroadEn_08421 pDONR223 100% 89.9% 95.9% None (many diffs) n/a
5 ccsbBroad304_08421 pLX_304 0% 89.9% 95.9% V5 (many diffs) n/a
Download CSV