Transcript: Mouse XM_006502406.3

PREDICTED: Mus musculus synovial sarcoma, X breakpoint 2 interacting protein (Ssx2ip), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ssx2ip (99167)
Length:
3552
CDS:
391..2238

Additional Resources:

NCBI RefSeq record:
XM_006502406.3
NBCI Gene record:
Ssx2ip (99167)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181884 GACGAACTTTGACCACCAGAA pLKO.1 1839 CDS 100% 4.050 5.670 N Ssx2ip n/a
2 TRCN0000292669 GACGAACTTTGACCACCAGAA pLKO_005 1839 CDS 100% 4.050 5.670 N Ssx2ip n/a
3 TRCN0000217305 GATAGCTGGATGCTCATATTT pLKO.1 3078 3UTR 100% 15.000 10.500 N Ssx2ip n/a
4 TRCN0000177409 GCTGAAATGCTAAGCTACTTA pLKO.1 2368 3UTR 100% 5.625 3.938 N Ssx2ip n/a
5 TRCN0000292742 GCTGAAATGCTAAGCTACTTA pLKO_005 2368 3UTR 100% 5.625 3.938 N Ssx2ip n/a
6 TRCN0000198569 GCAGTGCAAGAACAGGAGTTT pLKO.1 876 CDS 100% 4.950 3.465 N Ssx2ip n/a
7 TRCN0000198706 CAAAGATGTCTCCGTCCAGTT pLKO.1 467 CDS 100% 4.050 2.835 N Ssx2ip n/a
8 TRCN0000181325 CGAGACTGTTACTTGCTGGAA pLKO.1 1654 CDS 100% 2.640 1.848 N Ssx2ip n/a
9 TRCN0000292670 CGAGACTGTTACTTGCTGGAA pLKO_005 1654 CDS 100% 2.640 1.848 N Ssx2ip n/a
10 TRCN0000177481 GAGAGAACATTGAACAAAGTA pLKO.1 566 CDS 100% 5.625 3.375 N Ssx2ip n/a
11 TRCN0000292743 GAGAGAACATTGAACAAAGTA pLKO_005 566 CDS 100% 5.625 3.375 N Ssx2ip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09444 pDONR223 100% 83.9% 86.8% None (many diffs) n/a
2 ccsbBroad304_09444 pLX_304 0% 83.9% 86.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000474311 CCTGCGAGCGAGTGCTCAGTGCGT pLX_317 21.6% 83.9% 86.8% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_13063 pDONR223 100% 77.2% 81.3% None (many diffs) n/a
5 ccsbBroad304_13063 pLX_304 0% 77.2% 81.3% V5 (many diffs) n/a
6 TRCN0000475421 GAGCAAGCGCGCCTGATCAGTACT pLX_317 28.9% 77.2% 81.3% V5 (many diffs) n/a
Download CSV