Transcript: Mouse XM_006502695.1

PREDICTED: Mus musculus CAP, adenylate cyclase-associated protein 1 (yeast) (Cap1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cap1 (12331)
Length:
2775
CDS:
272..1696

Additional Resources:

NCBI RefSeq record:
XM_006502695.1
NBCI Gene record:
Cap1 (12331)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375173 TCCTACCGAAGGCGGTGATTT pLKO_005 1591 CDS 100% 13.200 18.480 N Cap1 n/a
2 TRCN0000105887 CCATTACAGTAGATAACTGTA pLKO.1 1374 CDS 100% 0.495 0.693 N Cap1 n/a
3 TRCN0000332180 CCATTACAGTAGATAACTGTA pLKO_005 1374 CDS 100% 0.495 0.693 N Cap1 n/a
4 TRCN0000105886 GCCAACCATTTCCATTAACAA pLKO.1 1483 CDS 100% 5.625 4.500 N Cap1 n/a
5 TRCN0000105889 CAGGCTTACATCAAGGAGTTT pLKO.1 848 CDS 100% 4.950 3.465 N Cap1 n/a
6 TRCN0000332251 CAGGCTTACATCAAGGAGTTT pLKO_005 848 CDS 100% 4.950 3.465 N Cap1 n/a
7 TRCN0000105888 GCAGGCTTACATCAAGGAGTT pLKO.1 847 CDS 100% 4.050 2.835 N Cap1 n/a
8 TRCN0000375242 CAGAGCTTACTTGAGTATATG pLKO_005 817 CDS 100% 13.200 7.920 N Cap1 n/a
9 TRCN0000105885 CCTCTACCTTTCTGCTCTTAA pLKO.1 1774 3UTR 100% 13.200 7.920 N Cap1 n/a
10 TRCN0000332250 CCTCTACCTTTCTGCTCTTAA pLKO_005 1774 3UTR 100% 13.200 7.920 N Cap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02454 pDONR223 100% 90.4% 95.3% None (many diffs) n/a
2 ccsbBroad304_02454 pLX_304 0% 90.4% 95.3% V5 (many diffs) n/a
3 TRCN0000480284 TGAGGTAACATTATCGGCACGAAG pLX_317 24.1% 90.4% 95.3% V5 (many diffs) n/a
Download CSV