Transcript: Mouse XM_006502855.3

PREDICTED: Mus musculus phosphodiesterase 4B, cAMP specific (Pde4b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pde4b (18578)
Length:
4464
CDS:
331..2541

Additional Resources:

NCBI RefSeq record:
XM_006502855.3
NBCI Gene record:
Pde4b (18578)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352450 CAACCGGATGCTCAAGATATT pLKO_005 2233 CDS 100% 13.200 18.480 N Pde4b n/a
2 TRCN0000114912 GCGAAGTGTAAGAAACAACTT pLKO.1 858 CDS 100% 4.950 6.930 N Pde4b n/a
3 TRCN0000114911 GCCGTGAAGCAAATAGCAGTT pLKO.1 2689 3UTR 100% 4.050 5.670 N Pde4b n/a
4 TRCN0000340662 CACTAACAACTTCATCTATAA pLKO_005 2875 3UTR 100% 13.200 10.560 N Pde4b n/a
5 TRCN0000340582 GGAGAAGGCCACAGCTATTTC pLKO_005 2416 CDS 100% 13.200 9.240 N Pde4b n/a
6 TRCN0000114913 GTAACCTACATGATGACTTTA pLKO.1 1495 CDS 100% 13.200 9.240 N Pde4b n/a
7 TRCN0000340583 GAGACCTTCTGAAGACGTTTA pLKO_005 1454 CDS 100% 10.800 7.560 N Pde4b n/a
8 TRCN0000114915 CCAGATAAGTGGAGTGAAGAA pLKO.1 1248 CDS 100% 4.950 3.465 N Pde4b n/a
9 TRCN0000048820 CCTTGGAATTGTATCGGCAAT pLKO.1 2042 CDS 100% 4.050 2.835 N PDE4B n/a
10 TRCN0000340584 ACCTTGCTGTGGGATTCAAAT pLKO_005 1766 CDS 100% 13.200 7.920 N Pde4b n/a
11 TRCN0000048821 GCTTGAGTAAATCCTACAGTT pLKO.1 398 CDS 100% 4.950 3.465 N PDE4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06703 pDONR223 100% 89.4% 97% None (many diffs) n/a
2 ccsbBroad304_06703 pLX_304 0% 89.4% 97% V5 (many diffs) n/a
3 TRCN0000477230 ACAAGCGGTCCATTGACATACTCA pLX_317 13.9% 89.4% 97% V5 (many diffs) n/a
Download CSV