Transcript: Mouse XM_006502908.1

PREDICTED: Mus musculus solute carrier family 2 (facilitated glucose transporter), member 1 (Slc2a1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc2a1 (20525)
Length:
2454
CDS:
104..1570

Additional Resources:

NCBI RefSeq record:
XM_006502908.1
NBCI Gene record:
Slc2a1 (20525)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079331 GTCGGGTATCAATGCTGTGTT pLKO.1 943 CDS 100% 4.950 6.930 N Slc2a1 n/a
2 TRCN0000311403 GTCCTATTCCATGGTTCATTG pLKO_005 1242 CDS 100% 10.800 8.640 N Slc2a1 n/a
3 TRCN0000079332 CATCCTTATTGCCCAGGTGTT pLKO.1 592 CDS 100% 4.050 3.240 N Slc2a1 n/a
4 TRCN0000353917 CATCCTTATTGCCCAGGTGTT pLKO_005 592 CDS 100% 4.050 3.240 N Slc2a1 n/a
5 TRCN0000418550 TGAGCATCGTGGCCATCTTTG pLKO_005 1191 CDS 100% 10.800 7.560 N SLC2A1 n/a
6 TRCN0000305719 TGAGGAGTTCTACAATCAAAC pLKO_005 211 CDS 100% 10.800 7.560 N Slc2a1 n/a
7 TRCN0000418373 TGGGCATGTGCTTCCAGTATG pLKO_005 1344 CDS 100% 10.800 7.560 N SLC2A1 n/a
8 TRCN0000079329 CGGCTATAACACTGGTGTCAT pLKO.1 169 CDS 100% 4.950 3.465 N Slc2a1 n/a
9 TRCN0000079328 GCTGAGAACTTAACTGCTGAA pLKO.1 2259 3UTR 100% 4.050 2.835 N Slc2a1 n/a
10 TRCN0000324209 GCTGAGAACTTAACTGCTGAA pLKO_005 2259 3UTR 100% 4.050 2.835 N Slc2a1 n/a
11 TRCN0000079330 CGGCCTCTTTGTTAATCGCTT pLKO.1 340 CDS 100% 2.640 1.848 N Slc2a1 n/a
12 TRCN0000311405 TCACTGTGGTGTCGCTGTTTG pLKO_005 1050 CDS 100% 10.800 6.480 N Slc2a1 n/a
13 TRCN0000424030 CCGCTTCATCATCGGTGTGTA pLKO_005 466 CDS 100% 4.950 2.970 N SLC2A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01540 pDONR223 100% 88.7% 96.3% None (many diffs) n/a
2 ccsbBroad304_01540 pLX_304 0% 88.7% 96.3% V5 (many diffs) n/a
3 TRCN0000476750 ATTGTGACCCCGATACGACAAGCG pLX_317 23.7% 88.7% 96.3% V5 (many diffs) n/a
4 TRCN0000488955 GGTGACCAGCAGTCTTTGTGTCGG pLX_317 23.7% 88.7% 96.1% V5 (many diffs) n/a
5 TRCN0000488453 TCACTGCCTATTCTCTGGCAAGAG pLX_317 23.3% 88.2% 96.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV