Construct: ORF TRCN0000489564
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021807.1_s317c1
- DNA Barcode:
- GTGATGCAAAAGTTTCGGTATTGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- SLC5A9 (200010)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489564
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | NM_001135181.2 | 99.9% | 99.8% | 882T>G |
| 2 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | NM_001011547.3 | 96.4% | 96.3% | 339_340ins75;807T>G |
| 3 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XM_011540924.2 | 91.2% | 91.1% | 409_525del;999T>G;1011_1012ins78 |
| 4 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XM_011540925.2 | 85.8% | 85.6% | (many diffs) |
| 5 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XM_011540927.1 | 82.3% | 72.7% | (many diffs) |
| 6 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XM_011540926.3 | 78% | 72.7% | (many diffs) |
| 7 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XM_017000558.1 | 71.9% | 69.2% | (many diffs) |
| 8 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XM_011540928.1 | 67.2% | 67.1% | 0_1ins693;189T>G |
| 9 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XM_011540929.2 | 57.2% | 54.8% | (many diffs) |
| 10 | human | 200010 | SLC5A9 | solute carrier family 5 mem... | XR_946573.2 | 52.1% | (many diffs) | |
| 11 | mouse | 230612 | Slc5a9 | solute carrier family 5 (so... | NM_145551.4 | 80.7% | 81.7% | (many diffs) |
| 12 | mouse | 230612 | Slc5a9 | solute carrier family 5 (so... | XM_006503000.2 | 80.7% | 81.7% | (many diffs) |
| 13 | mouse | 230612 | Slc5a9 | solute carrier family 5 (so... | XR_376307.3 | 50.3% | (many diffs) | |
| 14 | mouse | 230612 | Slc5a9 | solute carrier family 5 (so... | XM_006503002.3 | 46.8% | 48.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2187
- ORF length:
- 2118
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcat gagcaaggag ctggcagcaa tggggcctgg agcttcaggg gacggggtca 121 ggactgagac agctccacac atagcactgg actccagagt tggtctgcac gcctacgaca 181 tcagcgtggt ggtcatctac tttgtcttcg tcattgctgt ggggatctgg tcgtccatcc 241 gtgcaagtcg agggaccatt ggcggctatt tcctggccgg gaggtccatg agctggtggc 301 caattggagc atctctgatg tccagcaatg tgggcagtgg cttgttcatc ggcctggctg 361 ggacaggggc tgccggaggc cttgccgtag gtggcttcga gtggaacatg aggaaatcaa 421 ggtctggagg agacagaggg atccatccaa ggtcacacgg gaggactggg gtcaggtccc 481 aggcaacctg gctgctcctg gcccttggct gggtcttcgt ccctgtgtac atcgcagcag 541 gtgtggtcac aatgccgcag tatctgaaga agcgatttgg gggccagagg atccaggtgt 601 acatgtctgt cctgtctctc atcctctaca tcttcaccaa gatctcgact gacatcttct 661 ctggagccct cttcatccag atggcattgg gctggaacct gtacctctcc acagggatcc 721 tgctggtggt gactgccgtc tacaccattg caggtggcct catggccgtg atctacacag 781 atgctctgca gacggtgatc atggtagggg gagccctggt cctcatgttt ctgggctttc 841 aggacgtggg ctggtaccca ggcctggagc agcggtacag gcaggccatc cctaatgtca 901 cagtccccaa caccacctgt cacctcccac ggcccgatgc tttccacatg cttcgggacc 961 ctgtgagcgg ggacatccct tggccaggtc tcattttcgg gctcacagtg ctggccacct 1021 ggtgttggtg cacagaccag gtcattgtgc agcggtctct ctcggccaag agtctgtctc 1081 atgccaaggg aggctccgtg ctggggggct acctgaagat cctccccatg ttcttcatcg 1141 tcatgcctgg catgatcagc cgggccctgt tcccagacga ggtgggctgc gtggaccctg 1201 atgtctgcca aagaatctgt ggggcccgag tgggatgttc caacattgcc taccctaagt 1261 tggtcatggc cctcatgcct gttggtctgc gggggctgat gattgccgtg atcatggccg 1321 ctctcatgag ctcactcacc tccatcttca acagcagcag caccctgttc accattgatg 1381 tgtggcagcg cttccgcagg aagtcaacag agcaggagct gatggtggtg ggcagagtgt 1441 ttgtggtgtt cctggttgtc atcagcatcc tctggatccc catcatccaa agctccaaca 1501 gtgggcagct cttcgactac atccaggctg tcaccagtta cctggcccca cccatcaccg 1561 ctctcttcct gctggccatc ttctgcaaga gggtcacaga gcccggagct ttctggggcc 1621 tcgtgtttgg cctgggagtg gggcttctgc gtatgatcct ggagttctca tacccagcgc 1681 cagcctgtgg ggaggtggac cggaggccag cagtgctgaa ggacttccac tacctgtact 1741 ttgcaatcct cctctgcggg ctcactgcca tcgtcattgt cattgtcagc ctctgtacaa 1801 ctcccatccc tgaggaacag ctcacacgcc tcacatggtg gactcggaac tgccccctct 1861 ctgagctgga gaaggaggcc cacgagagca caccGGAGAT ATCCGAGAGG CCAGCCGGGG 1921 AGTGCCCTGC AGGAGGTGGA GCGGCAGAGA ACTCGAGCCT GGGCCAGGAG CAGCCTGAAG 1981 CCCCAAGCAG GTCCTGGGGA AAGTTGCTCT GGAGCTGGTT CTGTGGGCTC TCTGGAACAC 2041 CGGAGCAGGC CCTGAGCCCA GCAGAGAAGG CTGCGCTAGA ACAGAAGCTG ACAAGCATTG 2101 AGGAGGAGCC ACTCTGGAGA CATGTCTGCA ACATCAATGC TGTCCTTTTG CTGGCCATCA 2161 ACATCTTCCT CTGGGGCTAT TTTGCGTGAG ACCCAGCTTT CTTGTACAAA GTGGTTGATA 2221 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 2281 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGTGAT 2341 GCAAAAGTTT CGGTATTGCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 2401 tgaaagatt