Transcript: Mouse XM_006503796.3

PREDICTED: Mus musculus recombination signal binding protein for immunoglobulin kappa J region (Rbpj), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbpj (19664)
Length:
5841
CDS:
511..2100

Additional Resources:

NCBI RefSeq record:
XM_006503796.3
NBCI Gene record:
Rbpj (19664)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503796.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097287 CCCTGTGCGTTTATTGGAATA pLKO.1 892 CDS 100% 10.800 15.120 N Rbpj n/a
2 TRCN0000324658 CCCTGTGCGTTTATTGGAATA pLKO_005 892 CDS 100% 10.800 15.120 N Rbpj n/a
3 TRCN0000305837 TAGGGAAGCTATGCGAAATTA pLKO_005 693 CDS 100% 15.000 10.500 N Rbpj n/a
4 TRCN0000097288 CTGTATCACAACTCCACAAAT pLKO.1 1433 CDS 100% 13.200 9.240 N Rbpj n/a
5 TRCN0000097286 CCAGTGACTTTGGTCCGAAAT pLKO.1 1870 CDS 100% 10.800 7.560 N Rbpj n/a
6 TRCN0000324657 CCAGTGACTTTGGTCCGAAAT pLKO_005 1870 CDS 100% 10.800 7.560 N Rbpj n/a
7 TRCN0000097284 GCAGACTCATTGGGCTACATT pLKO.1 3591 3UTR 100% 5.625 3.938 N Rbpj n/a
8 TRCN0000353944 GCAGACTCATTGGGCTACATT pLKO_005 3591 3UTR 100% 5.625 3.938 N Rbpj n/a
9 TRCN0000097285 CCAGACAGTTAGTACCAGGTA pLKO.1 1182 CDS 100% 2.640 1.848 N Rbpj n/a
10 TRCN0000324721 CCAGACAGTTAGTACCAGGTA pLKO_005 1182 CDS 100% 2.640 1.848 N Rbpj n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503796.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06435 pDONR223 100% 83% 89.7% None (many diffs) n/a
2 ccsbBroad304_06435 pLX_304 38.7% 83% 89.7% V5 (many diffs) n/a
3 TRCN0000470066 CCAATAGATCCTTCAAGCAGAACC pLX_317 29.2% 83% 89.7% V5 (many diffs) n/a
Download CSV