Transcript: Mouse XM_006503827.4

PREDICTED: Mus musculus Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase (Sepsecs), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Sepsecs (211006)
Length:
1565
CDS:
77..895

Additional Resources:

NCBI RefSeq record:
XM_006503827.4
NBCI Gene record:
Sepsecs (211006)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503827.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257819 TTGGACGATCCGGTGATATTT pLKO_005 360 CDS 100% 15.000 21.000 N Sepsecs n/a
2 TRCN0000248929 CAAAGGCCAAGTATATCATAT pLKO_005 555 CDS 100% 13.200 9.240 N Sepsecs n/a
3 TRCN0000127512 CGGTGATATTTCTGCTGTGCA pLKO.1 370 CDS 100% 2.640 1.848 N SEPSECS n/a
4 TRCN0000433478 GCTGTGATTTGTGCTAATTAT pLKO_005 791 CDS 100% 15.000 9.000 N SEPSECS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503827.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11946 pDONR223 100% 44.8% 43.4% None (many diffs) n/a
2 ccsbBroadEn_11945 pDONR223 100% 37.7% 39.5% None (many diffs) n/a
3 ccsbBroad304_11945 pLX_304 0% 37.7% 39.5% V5 (many diffs) n/a
Download CSV