Transcript: Mouse XM_006503906.1

PREDICTED: Mus musculus actin-binding LIM protein 2 (Ablim2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ablim2 (231148)
Length:
3898
CDS:
197..2344

Additional Resources:

NCBI RefSeq record:
XM_006503906.1
NBCI Gene record:
Ablim2 (231148)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503906.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099425 CCCGCTAATGCTCTGTGTATT pLKO.1 2936 3UTR 100% 13.200 18.480 N Ablim2 n/a
2 TRCN0000099427 CCTCATCGTAACAAACCGAAT pLKO.1 2167 CDS 100% 4.050 5.670 N Ablim2 n/a
3 TRCN0000099429 CGTGTGATCTACGCAAAGCTT pLKO.1 1142 CDS 100% 3.000 4.200 N Ablim2 n/a
4 TRCN0000099426 GCTGATTATCACAGCAAGTTT pLKO.1 800 CDS 100% 5.625 3.938 N Ablim2 n/a
5 TRCN0000099428 CCTGTGTAATACCTGTGGGAA pLKO.1 262 CDS 100% 2.640 1.848 N Ablim2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503906.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09191 pDONR223 100% 63.2% 66.4% None (many diffs) n/a
2 ccsbBroad304_09191 pLX_304 0% 63.2% 66.4% V5 (many diffs) n/a
3 TRCN0000475266 CACGGTCTCTAGTGCACCCTAGTC pLX_317 27.8% 63.2% 66.4% V5 (many diffs) n/a
Download CSV