Transcript: Mouse XM_006504302.3

PREDICTED: Mus musculus splicing factor, suppressor of white-apricot homolog (Drosophila) (Sfswap), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sfswap (231769)
Length:
3407
CDS:
478..3090

Additional Resources:

NCBI RefSeq record:
XM_006504302.3
NBCI Gene record:
Sfswap (231769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504302.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277508 ACTTACGGCAGCGACTATTAT pLKO_005 553 CDS 100% 15.000 21.000 N Sfswap n/a
2 TRCN0000277507 GTCGCTAGAAACGGCCTTAAA pLKO_005 1495 CDS 100% 13.200 18.480 N Sfswap n/a
3 TRCN0000216210 CGTTGTTCTTACAAACCTTAA pLKO.1 2153 CDS 100% 10.800 15.120 N Sfswap n/a
4 TRCN0000178201 CAAGATCCTCATCGACAGATA pLKO.1 347 5UTR 100% 4.950 6.930 N Sfswap n/a
5 TRCN0000181277 CACAGCCAACTTCGTATGCAA pLKO.1 741 CDS 100% 3.000 4.200 N Sfswap n/a
6 TRCN0000198707 CGACTATTATGACCCGTCAGA pLKO.1 564 CDS 100% 2.640 2.112 N Sfswap n/a
7 TRCN0000277580 TGCCGACCTACATGCAGCTAT pLKO_005 3213 3UTR 100% 4.950 3.465 N Sfswap n/a
8 TRCN0000181797 GAGCAAGAACGAGGAGAAGAA pLKO.1 909 CDS 100% 4.950 2.970 N Sfswap n/a
9 TRCN0000277578 GAGCAAGAACGAGGAGAAGAA pLKO_005 909 CDS 100% 4.950 2.970 N Sfswap n/a
10 TRCN0000153398 GAAGAGGAAGATGATGAGGAT pLKO.1 955 CDS 100% 2.640 1.320 Y NPM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504302.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06938 pDONR223 100% 68% 72.6% None (many diffs) n/a
2 ccsbBroad304_06938 pLX_304 0% 68% 72.6% V5 (many diffs) n/a
3 TRCN0000481596 ATTCAGGAAAGCCCAAGGATTCTG pLX_317 14% 68% 72.6% V5 (many diffs) n/a
Download CSV