Transcript: Mouse XM_006504953.3

PREDICTED: Mus musculus transmembrane protein 168 (Tmem168), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem168 (101118)
Length:
3610
CDS:
689..2782

Additional Resources:

NCBI RefSeq record:
XM_006504953.3
NBCI Gene record:
Tmem168 (101118)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504953.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125681 GCGAAGACAGTAGATATTGAA pLKO.1 2402 CDS 100% 5.625 4.500 N Tmem168 n/a
2 TRCN0000323942 GCGAAGACAGTAGATATTGAA pLKO_005 2402 CDS 100% 5.625 4.500 N Tmem168 n/a
3 TRCN0000125680 GCCAGTTTAAGTCTCTCCAAT pLKO.1 956 CDS 100% 4.950 3.960 N Tmem168 n/a
4 TRCN0000305630 CTGGATGATTTGCCATATTAT pLKO_005 1600 CDS 100% 15.000 10.500 N Tmem168 n/a
5 TRCN0000305683 GACATCAAGGAAGGCTATTAT pLKO_005 2787 3UTR 100% 15.000 10.500 N Tmem168 n/a
6 TRCN0000305632 TCGCCAGCATACTCTACTATT pLKO_005 918 CDS 100% 13.200 9.240 N Tmem168 n/a
7 TRCN0000125682 CGACCTGAGAATGAAGTCTTT pLKO.1 1264 CDS 100% 4.950 3.465 N Tmem168 n/a
8 TRCN0000125683 GCCATATGTTTAGGCCTTTAT pLKO.1 827 CDS 100% 0.000 0.000 N Tmem168 n/a
9 TRCN0000305631 GGACCTAGACATGATACATAT pLKO_005 2162 CDS 100% 13.200 7.920 N Tmem168 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504953.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12470 pDONR223 100% 54.8% 58.5% None (many diffs) n/a
2 ccsbBroad304_12470 pLX_304 0% 54.8% 58.5% V5 (many diffs) n/a
3 TRCN0000471689 ATCGTTCCATTTGAGTGTCTTTAT pLX_317 36.6% 54.8% 58.5% V5 (many diffs) n/a
Download CSV