Transcript: Mouse XM_006505211.3

PREDICTED: Mus musculus centrosomal protein 41 (Cep41), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cep41 (83922)
Length:
3428
CDS:
110..1183

Additional Resources:

NCBI RefSeq record:
XM_006505211.3
NBCI Gene record:
Cep41 (83922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505211.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248719 TGTAGACAAAGGGCTCGTAAA pLKO_005 511 CDS 100% 10.800 8.640 N Cep41 n/a
2 TRCN0000196119 GATGTAGACAAAGGGCTCGTA pLKO.1 509 CDS 100% 2.640 2.112 N Cep41 n/a
3 TRCN0000216193 CAACGTACACATAGCTTTAAT pLKO.1 2766 3UTR 100% 15.000 10.500 N Cep41 n/a
4 TRCN0000257690 AGCCGACTGAACCAGAATAAC pLKO_005 1034 CDS 100% 13.200 9.240 N Cep41 n/a
5 TRCN0000248721 ATGTGAGTCCAGCTATGTTAA pLKO_005 1958 3UTR 100% 13.200 9.240 N Cep41 n/a
6 TRCN0000248722 GTTCGAGACAGAGATTCTTAT pLKO_005 593 CDS 100% 13.200 9.240 N Cep41 n/a
7 TRCN0000180048 CAGAACCCAAGGTATCAACAT pLKO.1 164 CDS 100% 4.950 3.465 N Cep41 n/a
8 TRCN0000180227 CCAGAATAACTCTGCTGGAAA pLKO.1 1045 CDS 100% 4.950 3.465 N Cep41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505211.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13007 pDONR223 100% 65.1% 66.2% None (many diffs) n/a
2 ccsbBroad304_13007 pLX_304 0% 65.1% 66.2% V5 (many diffs) n/a
3 TRCN0000480131 CCTTCTGCGCGAGTCCACAGGTCC pLX_317 42.5% 65.1% 66.2% V5 (many diffs) n/a
Download CSV