Transcript: Mouse XM_006505258.3

PREDICTED: Mus musculus EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase (Eogt), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eogt (101351)
Length:
4707
CDS:
1080..2663

Additional Resources:

NCBI RefSeq record:
XM_006505258.3
NBCI Gene record:
Eogt (101351)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505258.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264935 CTGTCAGAATACAGGATTATT pLKO_005 2084 CDS 100% 15.000 21.000 N Eogt n/a
2 TRCN0000264937 TACGTTATAGACCAGTAATTA pLKO_005 3365 3UTR 100% 15.000 21.000 N Eogt n/a
3 TRCN0000264939 ACGCACAACACGGACATATTT pLKO_005 2325 CDS 100% 15.000 10.500 N Eogt n/a
4 TRCN0000216330 GAAATTAGATGCAGGTATTAA pLKO.1 1793 CDS 100% 15.000 10.500 N Eogt n/a
5 TRCN0000264938 GAAATTAGATGCAGGTATTAA pLKO_005 1793 CDS 100% 15.000 10.500 N Eogt n/a
6 TRCN0000217396 GGATTCCCACTGTCCATATAA pLKO.1 1268 CDS 100% 15.000 10.500 N Eogt n/a
7 TRCN0000264936 GGATTCCCACTGTCCATATAA pLKO_005 1268 CDS 100% 15.000 10.500 N Eogt n/a
8 TRCN0000191610 GCTGTCAGAATACAGGATTAT pLKO.1 2083 CDS 100% 13.200 9.240 N Eogt n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3287 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505258.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05392 pDONR223 100% 71.2% 72.6% None (many diffs) n/a
2 ccsbBroad304_05392 pLX_304 0% 71.2% 72.6% V5 (many diffs) n/a
3 TRCN0000470580 ATAGAAGACTGCCCTACCCTTCTT pLX_317 36% 71.2% 72.6% V5 (many diffs) n/a
Download CSV