Transcript: Mouse XM_006505450.3

PREDICTED: Mus musculus protein disulfide isomerase associated 4 (Pdia4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pdia4 (12304)
Length:
2229
CDS:
435..1829

Additional Resources:

NCBI RefSeq record:
XM_006505450.3
NBCI Gene record:
Pdia4 (12304)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505450.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111776 CGAGAGAAATATGGGATTGTT pLKO.1 699 CDS 100% 5.625 7.875 N Pdia4 n/a
2 TRCN0000111779 GCTAACAACCTGAGAGAAGAT pLKO.1 870 CDS 100% 4.950 3.465 N Pdia4 n/a
3 TRCN0000316228 GCTAACAACCTGAGAGAAGAT pLKO_005 870 CDS 100% 4.950 3.465 N Pdia4 n/a
4 TRCN0000111777 CCCACGAGAGAAATATGGGAT pLKO.1 695 CDS 100% 2.640 1.848 N Pdia4 n/a
5 TRCN0000316302 CCCACGAGAGAAATATGGGAT pLKO_005 695 CDS 100% 2.640 1.848 N Pdia4 n/a
6 TRCN0000111775 CCACACTTTCAGCCCTGAAAT pLKO.1 902 CDS 100% 1.320 0.924 N Pdia4 n/a
7 TRCN0000316227 CCACACTTTCAGCCCTGAAAT pLKO_005 902 CDS 100% 1.320 0.924 N Pdia4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505450.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02208 pDONR223 100% 62.5% 61% None (many diffs) n/a
2 ccsbBroad304_02208 pLX_304 0% 62.5% 61% V5 (many diffs) n/a
3 TRCN0000466550 TCCGAAGTCGGTAGATTGACGGCG pLX_317 15.7% 62.5% 61% V5 (many diffs) n/a
Download CSV