Transcript: Mouse XM_006505732.3

PREDICTED: Mus musculus phosphodiesterase 1C (Pde1c), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pde1c (18575)
Length:
2673
CDS:
110..2539

Additional Resources:

NCBI RefSeq record:
XM_006505732.3
NBCI Gene record:
Pde1c (18575)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505732.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114923 CGGTCTTTGGTCAAGCAATTA pLKO.1 707 CDS 100% 13.200 10.560 N Pde1c n/a
2 TRCN0000114924 CGGTGACTTGAAAGACGGTAA pLKO.1 2377 CDS 100% 4.050 3.240 N Pde1c n/a
3 TRCN0000433484 GAAGATTGTGAGTCCATTAAT pLKO_005 1915 CDS 100% 15.000 10.500 N PDE1C n/a
4 TRCN0000114922 CCCATCAACAATTCTGTCATT pLKO.1 2051 CDS 100% 4.950 3.465 N Pde1c n/a
5 TRCN0000114925 CCGAGAAGATTGTGAGTCCAT pLKO.1 1911 CDS 100% 2.640 1.848 N Pde1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505732.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489302 TGCATTTGGATGGTAACTCATCGC pLX_317 20.1% 67.7% 68.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_06700 pDONR223 100% 67.3% 68.8% None (many diffs) n/a
3 ccsbBroad304_06700 pLX_304 0% 67.3% 68.8% V5 (many diffs) n/a
4 TRCN0000474141 CATGACTATCGAGCGACTGTGACG pLX_317 23.8% 67.3% 68.8% V5 (many diffs) n/a
Download CSV