Construct: ORF TRCN0000474141
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003417.1_s317c1
- Derived from:
- ccsbBroadEn_06700
- DNA Barcode:
- CATGACTATCGAGCGACTGTGACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PDE1C (5137)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474141
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001191056.3 | 99.7% | 99.8% | (many diffs) |
| 2 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001322056.1 | 99.7% | 99.8% | (many diffs) |
| 3 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001322057.1 | 99.7% | 99.8% | (many diffs) |
| 4 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_005020.5 | 99.7% | 99.8% | (many diffs) |
| 5 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001322058.2 | 89.3% | 85.1% | (many diffs) |
| 6 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001191057.4 | 88.9% | 88.7% | (many diffs) |
| 7 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001191059.3 | 88.9% | 88.7% | (many diffs) |
| 8 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001322055.1 | 88.9% | 88.7% | (many diffs) |
| 9 | human | 5137 | PDE1C | phosphodiesterase 1C | XM_017012267.1 | 88.9% | 88.7% | (many diffs) |
| 10 | human | 5137 | PDE1C | phosphodiesterase 1C | XM_017012266.1 | 85.1% | 81.1% | (many diffs) |
| 11 | human | 5137 | PDE1C | phosphodiesterase 1C | XM_017012265.1 | 82.4% | 78.4% | (many diffs) |
| 12 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001322059.1 | 80.6% | 76.9% | (many diffs) |
| 13 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001191058.4 | 80.4% | 76.4% | (many diffs) |
| 14 | human | 5137 | PDE1C | phosphodiesterase 1C | XM_017012264.1 | 77% | 73.1% | (many diffs) |
| 15 | human | 5137 | PDE1C | phosphodiesterase 1C | XR_001744802.1 | 63.5% | (many diffs) | |
| 16 | human | 5137 | PDE1C | phosphodiesterase 1C | XR_001744803.1 | 61.5% | (many diffs) | |
| 17 | human | 5137 | PDE1C | phosphodiesterase 1C | XR_001744804.1 | 32.9% | (many diffs) | |
| 18 | human | 5137 | PDE1C | phosphodiesterase 1C | XR_002956451.1 | 25.7% | (many diffs) | |
| 19 | human | 5137 | PDE1C | phosphodiesterase 1C | XR_001744806.1 | 20.3% | (many diffs) | |
| 20 | human | 5137 | PDE1C | phosphodiesterase 1C | XR_001744805.1 | 18.7% | (many diffs) | |
| 21 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_001025568.2 | 88.2% | 94.7% | (many diffs) |
| 22 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_001159960.1 | 88.2% | 94.7% | (many diffs) |
| 23 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_017321454.1 | 88.2% | 94.7% | (many diffs) |
| 24 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_001159952.1 | 86.9% | 93.3% | (many diffs) |
| 25 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_001159955.1 | 85% | 91.1% | (many diffs) |
| 26 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_011054.4 | 85% | 91.1% | (many diffs) |
| 27 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_011241250.2 | 85% | 91.1% | (many diffs) |
| 28 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_017321453.1 | 85% | 91.1% | (many diffs) |
| 29 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_001159957.1 | 83.3% | 89.5% | (many diffs) |
| 30 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_001159956.1 | 79.1% | 84.9% | (many diffs) |
| 31 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_011241251.1 | 79.1% | 84.9% | (many diffs) |
| 32 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_001159953.1 | 78.8% | 84.4% | (many diffs) |
| 33 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_006505735.2 | 73.3% | 78.7% | (many diffs) |
| 34 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_006505734.1 | 71.5% | 72.6% | (many diffs) |
| 35 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_006505733.3 | 69.3% | 71% | (many diffs) |
| 36 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_006505732.3 | 67.3% | 68.8% | (many diffs) |
| 37 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_006505730.3 | 63.2% | 64.7% | (many diffs) |
| 38 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XR_377431.1 | 47.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1968
- ORF length:
- 1902
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gtcgccaaca aaggagattg aagaatttga gagcaactct ctgaaatacc 121 tgcaaccgga acagatcgag aaaatctggc ttcggctccg cgggctgagg aaatataaga 181 aaacgtccca gagattacgg tctttggtca aacaattaga gagaggggaa gcttcagtgg 241 tagatcttaa gaagaatttg gaatatgcag ccacagtgct tgaatctgtg tatattgatg 301 aaacaaggag actcctggat acagaggatg agctcagtga cattcagtca gatgctgtgc 361 cttctgaggt ccgagactgg ctggcctcca ccttcacgcg gcagatgggg atgatgctca 421 ggaggagcga cgagaagccc cggttcaaga gcatcgttca cgcagtgcag gctgggatat 481 ttgtggagag aatgtataga cggacatcaa acatggttgg actgagctat ccaccagctg 541 ttattgaggc attaaaggat gtggacaagt ggtcatttga cgtcttttcc ctcaatgagg 601 ccagtgggga tcatgcactg aaatttattt tctatgaact actcacacgt tatgatctga 661 tcagccgttt caagatcccc atttctgcac ttgtctcatt tgtggaggcc ctggaagtgg 721 gatacagcaa gcacaaaaat ccttaccata acttaatgca cgctgccgat gttacacaga 781 cagtgcatta cctcctctat aagacaggag tggcgaactg gctgacggag ctggagatct 841 ttgctataat cttctcagct gccatccatg actacgagca taccggaacc accaacaatt 901 tccacattca gactcggtct gatccagcta ttctgtataa tgacagatct gtactggaga 961 atcaccattt aagtgcagct tatcgccttc tgcaagatga cgaggaaatg aatattttga 1021 ttaacctctc aaaggatgac tggagggagt ttcgaacctt ggtaattgaa atggtgatgg 1081 ccacagatat gtcttgtcac ttccaacaaa tcaaagcaat gaagactgct ctgcagcagc 1141 cagaagccat tgaaaagcca aaagccttat cccttatgct gcatacagca gatattagcc 1201 atccagcaaa agcatgggac ctccatcatc gctggacaat gtcactcctg gaggagttct 1261 tcagacaggg tgacagagaa gcagagctgg ggctgccttt ttctcctctg tgtgaccgaa 1321 agtccactat ggttgctcag tcacaagtag gtttcattga tttcatcgtg gaacccacct 1381 tcactgtgct tacggacatg accgagaaga ttgtgagtcc attaatcgat gaaacctctc 1441 aaactggtgg gacaggacag aggcgttcga gtttgaatag catcagctcg tcagatgcca 1501 agcgatcagg tgtcaagacc TCTGGTTCAG AGGGAAGTGC CCCGATCAAC AATTCTGTCA 1561 TCTCCGTTGA CTATAAGAGC TTTAAAGCTA CTTGGACGGA AGTGGTGCAC ATCAATCGGG 1621 AGAGATGGAG GGCCAAGGTA CCCAAAGAGG AGAAGGCCAA GAAGGAAGCA GAGGAAAAGG 1681 CTCGCATGGC CGCAGAGGAG CAGCAAAAGG AAATGGAAGC CAAAAGCCAG GCTGAAGAAG 1741 GCGCATCTGG CAAAGCTGAG AAAAAGACGT CTGGAGAAAC TAAGAATCAA GTCAATGGAA 1801 CACGGGCAAA CAAAAGTGAC AACCCTCGTG GGAAAAATTC CAAAGCCGAG AAGTCATCAG 1861 GAGAACAGCA ACAGAATGGT GACTTCAAAG ATGGTAAAAA TAAGACAGAC AAGAAGGATC 1921 ACTCTAACAT CGGAAATGAT TCAAAGAAAA CAGATGATTC ACAAGAGTAC CCAACTTTCT 1981 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 2041 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 2101 GTGGAAAGGA CGACATGACT ATCGAGCGAC TGTGACGACG CGTTAAGTCg acaatcaacc 2161 tctggattac aaaatttgtg aaagatt