Construct: ORF TRCN0000489302
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF022009.1_s317c1
- DNA Barcode:
- TGCATTTGGATGGTAACTCATCGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PDE1C (5137)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489302
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001191056.3 | 99.8% | 99.8% | 510C>A;1621C>A;1773C>T |
| 2 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001322056.1 | 99.8% | 99.8% | 510C>A;1621C>A;1773C>T |
| 3 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001322057.1 | 99.8% | 99.8% | 510C>A;1621C>A;1773C>T |
| 4 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_005020.5 | 99.8% | 99.8% | 510C>A;1621C>A;1773C>T |
| 5 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001322058.2 | 89.3% | 85.1% | (many diffs) |
| 6 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001191057.4 | 89% | 88.7% | (many diffs) |
| 7 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001191059.3 | 89% | 88.7% | (many diffs) |
| 8 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001322055.1 | 89% | 88.7% | (many diffs) |
| 9 | human | 5137 | PDE1C | phosphodiesterase 1C | XM_017012267.1 | 89% | 88.7% | (many diffs) |
| 10 | human | 5137 | PDE1C | phosphodiesterase 1C | XM_017012266.1 | 84.9% | 81.1% | (many diffs) |
| 11 | human | 5137 | PDE1C | phosphodiesterase 1C | XM_017012265.1 | 82.4% | 78.4% | (many diffs) |
| 12 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001322059.1 | 80.6% | 76.9% | (many diffs) |
| 13 | human | 5137 | PDE1C | phosphodiesterase 1C | NM_001191058.4 | 80.4% | 76.4% | (many diffs) |
| 14 | human | 5137 | PDE1C | phosphodiesterase 1C | XM_017012264.1 | 76.8% | 73.1% | (many diffs) |
| 15 | human | 5137 | PDE1C | phosphodiesterase 1C | XR_001744802.1 | 63.4% | (many diffs) | |
| 16 | human | 5137 | PDE1C | phosphodiesterase 1C | XR_001744803.1 | 61.4% | (many diffs) | |
| 17 | human | 5137 | PDE1C | phosphodiesterase 1C | XR_001744804.1 | 32.8% | (many diffs) | |
| 18 | human | 5137 | PDE1C | phosphodiesterase 1C | XR_002956451.1 | 25.8% | (many diffs) | |
| 19 | human | 5137 | PDE1C | phosphodiesterase 1C | XR_001744806.1 | 20.3% | (many diffs) | |
| 20 | human | 5137 | PDE1C | phosphodiesterase 1C | XR_001744805.1 | 18.7% | (many diffs) | |
| 21 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_001025568.2 | 88.3% | 94.7% | (many diffs) |
| 22 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_001159960.1 | 88.3% | 94.7% | (many diffs) |
| 23 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_017321454.1 | 88.3% | 94.7% | (many diffs) |
| 24 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_001159952.1 | 86.9% | 93.3% | (many diffs) |
| 25 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_001159955.1 | 85.1% | 91.1% | (many diffs) |
| 26 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_011054.4 | 85.1% | 91.1% | (many diffs) |
| 27 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_011241250.2 | 85.1% | 91.1% | (many diffs) |
| 28 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_017321453.1 | 85.1% | 91.1% | (many diffs) |
| 29 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_001159957.1 | 83.3% | 89.5% | (many diffs) |
| 30 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_001159956.1 | 79.1% | 84.9% | (many diffs) |
| 31 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_011241251.1 | 79.1% | 84.9% | (many diffs) |
| 32 | mouse | 18575 | Pde1c | phosphodiesterase 1C | NM_001159953.1 | 78.9% | 84.4% | (many diffs) |
| 33 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_006505735.2 | 73.3% | 78.7% | (many diffs) |
| 34 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_006505734.1 | 71.4% | 72.6% | (many diffs) |
| 35 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_006505733.3 | 69.7% | 71% | (many diffs) |
| 36 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_006505732.3 | 67.7% | 68.8% | (many diffs) |
| 37 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XM_006505730.3 | 63.6% | 64.7% | (many diffs) |
| 38 | mouse | 18575 | Pde1c | phosphodiesterase 1C | XR_377431.1 | 47.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1971
- ORF length:
- 1902
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggagtcgcca accaaggaga ttgaagaatt tgagagcaac tctctgaaat 121 acctgcaacc ggaacagatc gagaaaatct ggcttcggct ccgcgggctg aggaaatata 181 agaaaacgtc ccagagatta cggtctttgg tcaaacaatt agagagaggg gaagcttcag 241 tggtagatct taagaagaat ttggaatatg cagccacagt gcttgaatct gtgtatattg 301 atgaaacaag gagactcctg gatacagagg atgagctcag tgacattcag tcagatgctg 361 tgccttctga ggtccgagac tggctggcct ccaccttcac gcggcagatg gggatgatgc 421 tcaggaggag cgacgagaag ccccggttca agagcatcgt tcacgcagtg caggctggga 481 tatttgtgga gagaatgtat agacggacat caaacatggt tggactgagc tatccaccag 541 ctgttattga ggcattaaag gatgtggaca agtggtcatt tgacgtcttt tccctcaatg 601 aggccagtgg ggatcatgca ctgaaattta ttttctatga actactcaca cgttatgatc 661 tgatcagccg tttcaagatc cccatttctg cacttgtctc atttgtggag gccctggaag 721 tgggatacag caagcacaaa aatccttacc ataacttaat gcacgctgcc gatgttacac 781 agacagtgca ttacctcctc tataagacag gagtggcgaa ctggctgacg gagctggaga 841 tctttgctat aatcttctca gctgccatcc atgactacga gcataccgga accaccaaca 901 atttccacat tcagactcgg tctgatccag ctattctgta taatgacaga tctgtactgg 961 agaatcacca tttaagtgca gcttatcgcc ttctgcaaga tgacgaggaa atgaatattt 1021 tgattaacct ctcaaaggat gactggaggg agtttcgaac cttggtaatt gaaatggtga 1081 tggccacaga tatgtcttgt cacttccaac aaatcaaagc aatgaagact gctctgcagc 1141 agccagaagc cattgaaaag ccaaaagcct tatcccttat gctgcataca gcagatatta 1201 gccatccagc aaaagcatgg gacctccatc atcgctggac aatgtcactc ctggaggagt 1261 tcttcagaca gggtgacaga gaagcagagc tggggctgcc tttttctcct ctgtgtgacc 1321 gaaagtccac tatggttgct cagtcacaag taggtttcat tgatttcatc gtggaaccca 1381 ccttcactgt gcttacggac atgaccgaga agattgtgag tccattaatc gatgaaacct 1441 ctcaaactgg tgggacagga cagaggcgtt cgagtttgaa tagcatcagc tcgtcagatg 1501 ccaagcgatc aggtgtcaag acctctggtt cagagggaag tgccccgatc aacaattctg 1561 tcatctccgt tgactataag agctttaaag ctacttGGAC GGAAGTGGTG CACATCAATC 1621 GGGAGAGATG GAGGGCCAAG GTACCCAAAG AGGAGAAGGC CAAGAAGGAA GCAGAGGAAA 1681 AGGCTCGCAT GGCCGCAGAG GAGCAGCAAA AGGAAATGGA AGCCAAAAGC CAGGCTGAAG 1741 AAGGCGCATC TGGCAAAGCT GAGAAAAAGA CGTCTGGAGA AACTAAGAAT CAAGTCAATG 1801 GAACACGGGC AAACAAAAGT GACAACCCTC GTGGGAAAAA TTCCAAAGCC GAGAAGTCAT 1861 CAGGAGAACA GCAACAGAAT GGTGACTTCA AAGATGGTAA AAATAAGACA GACAAGAAGG 1921 ATCACTCTAA CATCGGAAAT GATTCAAAGA AAACAGATGA TTCACAAGAG TAAGACCCAG 1981 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 2041 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 2101 TATCTTGTGG AAAGGACGAT GCATTTGGAT GGTAACTCAT CGCACGCGTT AAGTCgacaa 2161 tcaacctctg gattacaaaa tttgtgaaag att