Transcript: Mouse XM_006506144.1

PREDICTED: Mus musculus SLIT-ROBO Rho GTPase activating protein 3 (Srgap3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Srgap3 (259302)
Length:
9080
CDS:
949..4263

Additional Resources:

NCBI RefSeq record:
XM_006506144.1
NBCI Gene record:
Srgap3 (259302)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106033 CCTCGTGAACTATCCTTCAAA pLKO.1 3241 CDS 100% 5.625 7.875 N Srgap3 n/a
2 TRCN0000106031 CGCAGCTATCAGCAAATACTA pLKO.1 1701 CDS 100% 5.625 4.500 N Srgap3 n/a
3 TRCN0000106030 CCACTCTTACTTGGTGGGATT pLKO.1 4818 3UTR 100% 4.050 3.240 N Srgap3 n/a
4 TRCN0000106032 GCCGATCTACAGAGTCCATAA pLKO.1 2162 CDS 100% 10.800 7.560 N Srgap3 n/a
5 TRCN0000106034 GCAGGCCAAGTATTCTGAGAA pLKO.1 1623 CDS 100% 4.950 3.465 N Srgap3 n/a
6 TRCN0000047564 GCTGAATATGAAGCCCAAATA pLKO.1 991 CDS 100% 13.200 7.920 N SRGAP3 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5903 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11429 pDONR223 100% 27.7% 29% None (many diffs) n/a
2 ccsbBroad304_11429 pLX_304 0% 27.7% 29% V5 (many diffs) n/a
3 TRCN0000467233 TAACACCTGACTCACCTCTCTGGT pLX_317 27% 27.7% 29% V5 (many diffs) n/a
Download CSV