Transcript: Mouse XM_006506217.1

PREDICTED: Mus musculus DNA segment, Chr 6, Wayne State University 163, expressed (D6Wsu163e), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
D6Wsu163e (28040)
Length:
2454
CDS:
295..1953

Additional Resources:

NCBI RefSeq record:
XM_006506217.1
NBCI Gene record:
D6Wsu163e (28040)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506217.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215576 GCTAGTAGATAATCGAATTAA pLKO.1 1284 CDS 100% 15.000 21.000 N D6Wsu163e n/a
2 TRCN0000247465 GCTAGTAGATAATCGAATTAA pLKO_005 1284 CDS 100% 15.000 21.000 N D6Wsu163e n/a
3 TRCN0000247462 TGCTCGGGATCCCGCTATTAT pLKO_005 1626 CDS 100% 15.000 21.000 N D6Wsu163e n/a
4 TRCN0000247464 ATAACGTGAAGTCGGGAAATA pLKO_005 1601 CDS 100% 13.200 18.480 N D6Wsu163e n/a
5 TRCN0000247463 GATGCTCTGAGCCGGTTTATA pLKO_005 481 CDS 100% 15.000 12.000 N D6Wsu163e n/a
6 TRCN0000216764 GATAACGTGAAGTCGGGAAAT pLKO.1 1600 CDS 100% 10.800 8.640 N D6Wsu163e n/a
7 TRCN0000257785 AGCTCTTCTTTCTACTTATAT pLKO_005 2162 3UTR 100% 15.000 10.500 N D6Wsu163e n/a
8 TRCN0000191945 GCATGATATGTCAGAGGAAAT pLKO.1 1719 CDS 100% 10.800 7.560 N D6Wsu163e n/a
9 TRCN0000136680 GCTGGACTTCTGTAAGCATAA pLKO.1 1179 CDS 100% 10.800 7.560 N C12orf4 n/a
10 TRCN0000200880 GTCATTCTAATCTCTCGGAAA pLKO.1 1550 CDS 100% 4.050 2.835 N D6Wsu163e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506217.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03781 pDONR223 100% 86.2% 94.2% None (many diffs) n/a
2 ccsbBroad304_03781 pLX_304 0% 86.2% 94.2% V5 (many diffs) n/a
3 TRCN0000474427 CCCATCTACTAGCATTGGGAGGTT pLX_317 19.2% 86.2% 94.2% V5 (many diffs) n/a
Download CSV