Transcript: Mouse XM_006506556.3

PREDICTED: Mus musculus zinc finger protein 746 (Zfp746), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp746 (69228)
Length:
3819
CDS:
357..2378

Additional Resources:

NCBI RefSeq record:
XM_006506556.3
NBCI Gene record:
Zfp746 (69228)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156664 GCTGGAATTTCCGGTGTAAAC pLKO.1 1561 CDS 100% 10.800 15.120 N ZNF746 n/a
2 TRCN0000158170 CTCTGGTGTCCATTCCAACTT pLKO.1 1127 CDS 100% 4.950 3.960 N ZNF746 n/a
3 TRCN0000238856 GGAACCCTGCTGCAGGAATAT pLKO_005 558 CDS 100% 13.200 9.240 N Zfp746 n/a
4 TRCN0000238855 CCCTGACCTCCTGATGCAAAT pLKO_005 962 CDS 100% 10.800 7.560 N Zfp746 n/a
5 TRCN0000238858 CCGATTTCTCCATGGACAATG pLKO_005 378 CDS 100% 10.800 7.560 N Zfp746 n/a
6 TRCN0000164872 GTCCTCTCCCAGATTGAACAA pLKO.1 831 CDS 100% 4.950 3.465 N ZNF767P n/a
7 TRCN0000238857 TATGGAGAGGAAGATTGAATC pLKO_005 416 CDS 100% 10.800 6.480 N Zfp746 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10522 pDONR223 100% 15.5% 16.3% None (many diffs) n/a
2 ccsbBroad304_10522 pLX_304 0% 15.5% 16.3% V5 (many diffs) n/a
3 TRCN0000466099 CTGACAACCTTTTAGAATTATCCT pLX_317 100% 15.5% 16.3% V5 (many diffs) n/a
Download CSV