Transcript: Mouse XM_006506649.3

PREDICTED: Mus musculus solute carrier family 25 (mitochondrial carrier), member 18 (Slc25a18), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc25a18 (71803)
Length:
2780
CDS:
1292..2254

Additional Resources:

NCBI RefSeq record:
XM_006506649.3
NBCI Gene record:
Slc25a18 (71803)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506649.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068301 CACTCCAGAGAAGGCAATCAA pLKO.1 1531 CDS 100% 5.625 7.875 N Slc25a18 n/a
2 TRCN0000068302 GTTTCCCATTGACCTTGCCAA pLKO.1 1384 CDS 100% 2.640 3.696 N Slc25a18 n/a
3 TRCN0000068298 GAGCGCATCTTGAAGTGCTTT pLKO.1 2228 CDS 100% 4.950 3.960 N Slc25a18 n/a
4 TRCN0000068299 CCCTTTGTTTGCAAACCTGAA pLKO.1 1909 CDS 100% 4.050 2.835 N Slc25a18 n/a
5 TRCN0000068300 GATGTTCTGAAGACTCGAATT pLKO.1 2033 CDS 100% 0.000 0.000 N Slc25a18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506649.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04293 pDONR223 100% 83.9% 86.5% None (many diffs) n/a
2 ccsbBroad304_04293 pLX_304 0% 83.9% 86.5% V5 (many diffs) n/a
3 TRCN0000469151 TATCTCGATTCCAATCGGTCAGCC pLX_317 35.1% 83.9% 86.5% V5 (many diffs) n/a
4 TRCN0000488084 GCGCTGGTGGTCCTGCATCGCGTT pLX_317 31.1% 83.9% 86.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488782 GAACCCAGATTCTCACCTGGCCTA pLX_317 33.8% 83.8% 86.2% V5 (many diffs) n/a
Download CSV