Transcript: Mouse XM_006506708.3

PREDICTED: Mus musculus autophagy related 7 (Atg7), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atg7 (74244)
Length:
2491
CDS:
103..2247

Additional Resources:

NCBI RefSeq record:
XM_006506708.3
NBCI Gene record:
Atg7 (74244)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506708.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305991 TTCTGTCACGGTTCGATAATG pLKO_005 2021 CDS 100% 13.200 18.480 N Atg7 n/a
2 TRCN0000092165 CGTGACACATAGCATCATCTT pLKO.1 972 CDS 100% 4.950 3.960 N Atg7 n/a
3 TRCN0000375421 TCTTACCCTGCTCCATCAAGA pLKO_005 2178 CDS 100% 4.950 3.960 N Atg7 n/a
4 TRCN0000092163 CCAGCTCTGAACTCAATAATA pLKO.1 2409 3UTR 100% 15.000 10.500 N Atg7 n/a
5 TRCN0000305993 GCAGTGATGACCGCATGAATG pLKO_005 1955 CDS 100% 10.800 7.560 N Atg7 n/a
6 TRCN0000305928 GTCCTTCCATGTGCACTAATC pLKO_005 2461 3UTR 100% 10.800 7.560 N Atg7 n/a
7 TRCN0000092164 GCCTGGCATTTGATAAATGTA pLKO.1 2054 CDS 100% 5.625 3.938 N Atg7 n/a
8 TRCN0000375444 GCCAACATCCCTGGATACAAG pLKO_005 1756 CDS 100% 4.950 3.465 N Atg7 n/a
9 TRCN0000092166 CCTAAAGAAGTACCACTTCTA pLKO.1 552 CDS 100% 0.495 0.347 N Atg7 n/a
10 TRCN0000325414 CCTAAAGAAGTACCACTTCTA pLKO_005 552 CDS 100% 0.495 0.347 N Atg7 n/a
11 TRCN0000092167 CCAAGGTCAAAGGACAAAGAT pLKO.1 798 CDS 100% 5.625 3.375 N Atg7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506708.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02460 pDONR223 100% 81.3% 87.4% None (many diffs) n/a
2 ccsbBroad304_02460 pLX_304 0% 81.3% 87.4% V5 (many diffs) n/a
3 TRCN0000472530 ACCACTTTTGACACCTGTACTAAC pLX_317 21.4% 81.3% 87.4% V5 (many diffs) n/a
Download CSV