Transcript: Mouse XM_006507138.1

PREDICTED: Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 32 (Dhx32), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dhx32 (101437)
Length:
3116
CDS:
575..2830

Additional Resources:

NCBI RefSeq record:
XM_006507138.1
NBCI Gene record:
Dhx32 (101437)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305465 ACCGTATTCATCGCGATATTA pLKO_005 733 CDS 100% 15.000 21.000 N Dhx32 n/a
2 TRCN0000113061 CGGGTCAGGTAACTACTTGAT pLKO.1 2497 CDS 100% 4.950 6.930 N Dhx32 n/a
3 TRCN0000317048 CGGGTCAGGTAACTACTTGAT pLKO_005 2497 CDS 100% 4.950 6.930 N Dhx32 n/a
4 TRCN0000305467 GACATGAACACTTCAAGTATG pLKO_005 2894 3UTR 100% 10.800 8.640 N Dhx32 n/a
5 TRCN0000113062 CCTGTCATAGAAGTGAGAAAT pLKO.1 1292 CDS 100% 13.200 9.240 N Dhx32 n/a
6 TRCN0000316973 CCTGTCATAGAAGTGAGAAAT pLKO_005 1292 CDS 100% 13.200 9.240 N Dhx32 n/a
7 TRCN0000113060 CCTGTGAACAAGATATTGAAA pLKO.1 1434 CDS 100% 5.625 3.938 N Dhx32 n/a
8 TRCN0000113064 GCCTGTGAACAAGATATTGAA pLKO.1 1433 CDS 100% 5.625 3.938 N Dhx32 n/a
9 TRCN0000316981 GCCTGTGAACAAGATATTGAA pLKO_005 1433 CDS 100% 5.625 3.938 N Dhx32 n/a
10 TRCN0000113063 GCCTGTCATAGAAGTGAGAAA pLKO.1 1291 CDS 100% 4.950 3.465 N Dhx32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08580 pDONR223 100% 82.5% 86.9% None (many diffs) n/a
2 ccsbBroad304_08580 pLX_304 0% 82.5% 86.9% V5 (many diffs) n/a
3 TRCN0000472545 TCAGCCACCTGCCGAGTAATGTTG pLX_317 20.8% 82.5% 86.9% V5 (many diffs) n/a
Download CSV