Transcript: Mouse XM_006507153.2

PREDICTED: Mus musculus pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 (Plekha1), transcript variant X14, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plekha1 (101476)
Length:
3800
CDS:
276..1280

Additional Resources:

NCBI RefSeq record:
XM_006507153.2
NBCI Gene record:
Plekha1 (101476)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507153.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173218 CGGGTGATACCACTTAAAGAA pLKO.1 972 CDS 100% 5.625 7.875 N Plekha1 n/a
2 TRCN0000320318 CGGGTGATACCACTTAAAGAA pLKO_005 972 CDS 100% 5.625 7.875 N Plekha1 n/a
3 TRCN0000175160 GCCATTAAACTTACCTACATT pLKO.1 447 CDS 100% 5.625 4.500 N Plekha1 n/a
4 TRCN0000350232 GCCATTAAACTTACCTACATT pLKO_005 447 CDS 100% 5.625 4.500 N Plekha1 n/a
5 TRCN0000158406 CCAGCTTCCAAAGTGACTGAA pLKO.1 1519 3UTR 100% 4.950 3.465 N PLEKHA1 n/a
6 TRCN0000343822 CCAGCTTCCAAAGTGACTGAA pLKO_005 1519 3UTR 100% 4.950 3.465 N PLEKHA1 n/a
7 TRCN0000173960 GCTGGGTATTGTGTGAAGCAA pLKO.1 858 CDS 100% 3.000 2.100 N Plekha1 n/a
8 TRCN0000320317 GCTGGGTATTGTGTGAAGCAA pLKO_005 858 CDS 100% 3.000 2.100 N Plekha1 n/a
9 TRCN0000154842 GCACAGTTGGATTAAAGCAGT pLKO.1 1106 CDS 100% 2.640 1.584 N PLEKHA1 n/a
10 TRCN0000343759 GCACAGTTGGATTAAAGCAGT pLKO_005 1106 CDS 100% 2.640 1.584 N PLEKHA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507153.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03875 pDONR223 100% 73% 72.6% None (many diffs) n/a
2 ccsbBroad304_03875 pLX_304 0% 73% 72.6% V5 (many diffs) n/a
3 TRCN0000478967 TGGGAACGGACATTTAACCCGGCC pLX_317 36.8% 73% 72.6% V5 (many diffs) n/a
Download CSV