Transcript: Mouse XM_006507438.3

PREDICTED: Mus musculus phosphodiesterase 3B, cGMP-inhibited (Pde3b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pde3b (18576)
Length:
8517
CDS:
3660..6908

Additional Resources:

NCBI RefSeq record:
XM_006507438.3
NBCI Gene record:
Pde3b (18576)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507438.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413190 GCTAAATGAAGCTCGCAATAT pLKO_005 4658 CDS 100% 13.200 18.480 N Pde3b n/a
2 TRCN0000114954 CCCACTCAAGAATTTATGAAT pLKO.1 5682 CDS 100% 5.625 7.875 N Pde3b n/a
3 TRCN0000114953 GCGGAGTATCAGTAGCTTGAT pLKO.1 4733 CDS 100% 4.950 6.930 N Pde3b n/a
4 TRCN0000433700 GGCTTACCTCAGATCCATAAT pLKO_005 5811 CDS 100% 13.200 10.560 N Pde3b n/a
5 TRCN0000114951 GCCTTAATACTGTGAGAGGAT pLKO.1 7008 3UTR 100% 2.640 2.112 N Pde3b n/a
6 TRCN0000439793 GAAAGCCTGCAGGGAGTTATT pLKO_005 5426 CDS 100% 13.200 9.240 N Pde3b n/a
7 TRCN0000114952 GCAGATGAGATTCAGGTTATT pLKO.1 6849 CDS 100% 13.200 9.240 N Pde3b n/a
8 TRCN0000114955 ACCACAAGATATGGAAGGAAA pLKO.1 6754 CDS 100% 4.950 3.465 N Pde3b n/a
9 TRCN0000429822 TGCTGTTCCCAGGGTCATTAC pLKO_005 6939 3UTR 100% 10.800 6.480 N Pde3b n/a
10 TRCN0000048793 GCTCGCAATATGGTGTCAGAT pLKO.1 4668 CDS 100% 4.950 3.960 N PDE3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507438.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06702 pDONR223 100% 82% 79.2% None (many diffs) n/a
2 ccsbBroad304_06702 pLX_304 0% 82% 79.2% V5 (many diffs) n/a
3 TRCN0000470356 GTTAATAAGAAGTCGGGGCTCCGA pLX_317 11.3% 82% 79.2% V5 (many diffs) n/a
Download CSV