Transcript: Mouse XM_006507562.2

PREDICTED: Mus musculus TEA domain family member 1 (Tead1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tead1 (21676)
Length:
2214
CDS:
168..1415

Additional Resources:

NCBI RefSeq record:
XM_006507562.2
NBCI Gene record:
Tead1 (21676)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507562.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085865 GCTCGCCAATGTGTGAATATA pLKO.1 1198 CDS 100% 15.000 21.000 N Tead1 n/a
2 TRCN0000085864 CGCTCGCCAATGTGTGAATAT pLKO.1 1197 CDS 100% 13.200 18.480 N Tead1 n/a
3 TRCN0000331765 CGCTCGCCAATGTGTGAATAT pLKO_005 1197 CDS 100% 13.200 18.480 N Tead1 n/a
4 TRCN0000374223 GGCGTCTGGAGTCCTGATATT pLKO_005 219 CDS 100% 13.200 18.480 N Tead1 n/a
5 TRCN0000085863 GCTTGGTTGAACTATCCTAAT pLKO.1 2021 3UTR 100% 10.800 15.120 N Tead1 n/a
6 TRCN0000301799 GCTTGGTTGAACTATCCTAAT pLKO_005 2021 3UTR 100% 10.800 15.120 N Tead1 n/a
7 TRCN0000374164 GTGTATTTGAAGTCTCGAATA pLKO_005 1348 CDS 100% 10.800 15.120 N Tead1 n/a
8 TRCN0000085866 CCATTCTTACAGTGACCCGTT pLKO.1 872 CDS 100% 2.160 1.728 N Tead1 n/a
9 TRCN0000311009 CTGTGGACATTCGTCAGATAT pLKO_005 901 CDS 100% 13.200 9.240 N Tead1 n/a
10 TRCN0000304525 TCAAATTCTGGGCGGACTTAA pLKO_005 997 CDS 100% 13.200 9.240 N Tead1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507562.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11185 pDONR223 100% 77.2% 83.3% None (many diffs) n/a
2 ccsbBroad304_11185 pLX_304 0% 77.2% 83.3% V5 (many diffs) n/a
3 TRCN0000467289 TTGGGCCAAGATATCTAAGAACAG pLX_317 31.5% 77.2% 83.3% V5 (many diffs) n/a
Download CSV