Transcript: Mouse XM_006507737.2

PREDICTED: Mus musculus seizure related 6 homolog like 2 (Sez6l2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sez6l2 (233878)
Length:
3770
CDS:
603..3242

Additional Resources:

NCBI RefSeq record:
XM_006507737.2
NBCI Gene record:
Sez6l2 (233878)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507737.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101095 CTCTGCTTAGTTGCCAAACAA pLKO.1 3436 3UTR 100% 5.625 7.875 N Sez6l2 n/a
2 TRCN0000101099 CTCCAAGTTGAAATCTTGAAT pLKO.1 2169 CDS 100% 5.625 3.938 N Sez6l2 n/a
3 TRCN0000101096 GCGTTTACATATACTACACTA pLKO.1 3094 CDS 100% 4.950 3.465 N Sez6l2 n/a
4 TRCN0000101098 CCTAGATTGCACCTACAGCAT pLKO.1 1067 CDS 100% 2.640 1.848 N Sez6l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507737.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08016 pDONR223 100% 73.5% 80.4% None (many diffs) n/a
2 ccsbBroad304_08016 pLX_304 0% 73.5% 80.4% V5 (many diffs) n/a
3 TRCN0000478879 GATCTATATGCGACAGGGGTCAGC pLX_317 16.2% 73.5% 80.4% V5 (many diffs) n/a
Download CSV