Transcript: Mouse XM_006508022.2

PREDICTED: Mus musculus CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) (Cdipt), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdipt (52858)
Length:
2084
CDS:
601..1263

Additional Resources:

NCBI RefSeq record:
XM_006508022.2
NBCI Gene record:
Cdipt (52858)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035985 CGGATTGTCTTCGCCATCATT pLKO.1 652 CDS 100% 5.625 7.875 N CDIPT n/a
2 TRCN0000333189 CGGATTGTCTTCGCCATCATT pLKO_005 652 CDS 100% 5.625 7.875 N CDIPT n/a
3 TRCN0000075745 CGTGCCTAACCTTATCGGTTA pLKO.1 627 CDS 100% 0.405 0.567 N Cdipt n/a
4 TRCN0000324959 CGTGCCTAACCTTATCGGTTA pLKO_005 627 CDS 100% 0.405 0.567 N Cdipt n/a
5 TRCN0000075743 GCTCTGGAAACCTCCACAATA pLKO.1 1705 3UTR 100% 13.200 9.240 N Cdipt n/a
6 TRCN0000324960 GCTCTGGAAACCTCCACAATA pLKO_005 1705 3UTR 100% 13.200 9.240 N Cdipt n/a
7 TRCN0000075744 CCTGTGCTTCGGATCTACTAT pLKO.1 985 CDS 100% 5.625 3.938 N Cdipt n/a
8 TRCN0000324958 CCTGTGCTTCGGATCTACTAT pLKO_005 985 CDS 100% 5.625 3.938 N Cdipt n/a
9 TRCN0000075746 TGCCTCCTGTATCTCTTCAAT pLKO.1 1078 CDS 100% 5.625 3.938 N Cdipt n/a
10 TRCN0000325032 TGCCTCCTGTATCTCTTCAAT pLKO_005 1078 CDS 100% 5.625 3.938 N Cdipt n/a
11 TRCN0000075747 CCTTAATCAAGGAACCCGGTT pLKO.1 768 CDS 100% 2.160 1.512 N Cdipt n/a
12 TRCN0000035987 GAGTCACAAGATGATCGACTT pLKO.1 954 CDS 100% 4.050 2.835 N CDIPT n/a
13 TRCN0000333273 GAGTCACAAGATGATCGACTT pLKO_005 954 CDS 100% 4.050 2.835 N CDIPT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02425 pDONR223 100% 86.6% 93.1% None (many diffs) n/a
2 ccsbBroad304_02425 pLX_304 0% 86.6% 93.1% V5 (many diffs) n/a
3 TRCN0000468452 TTGCTATTACCCGTTAAAAGCTTC pLX_317 58.5% 86.6% 93.1% V5 (many diffs) n/a
Download CSV