Transcript: Mouse XM_006508734.1

PREDICTED: Mus musculus RAS p21 protein activator 3 (Rasa3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rasa3 (19414)
Length:
4093
CDS:
212..2620

Additional Resources:

NCBI RefSeq record:
XM_006508734.1
NBCI Gene record:
Rasa3 (19414)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508734.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314102 TGAGGTTAAATGTCGTTTATA pLKO_005 963 CDS 100% 15.000 12.000 N Rasa3 n/a
2 TRCN0000350092 GGGATCCAGGGATCTGTTAAA pLKO_005 2888 3UTR 100% 13.200 9.240 N Rasa3 n/a
3 TRCN0000350091 GAGTCGTACATGGCGACATTC pLKO_005 1718 CDS 100% 10.800 7.560 N Rasa3 n/a
4 TRCN0000034358 GAGGAGTCCTTCCGAATGAAA pLKO.1 2024 CDS 100% 5.625 3.938 N Rasa3 n/a
5 TRCN0000034355 CCATGTCTTCTCCTCTGAGTA pLKO.1 991 CDS 100% 4.950 3.465 N Rasa3 n/a
6 TRCN0000317829 CCATGTCTTCTCCTCTGAGTA pLKO_005 991 CDS 100% 4.950 3.465 N Rasa3 n/a
7 TRCN0000034354 CCTGCTTAAAGAAGGGTTCAT pLKO.1 1843 CDS 100% 4.950 3.465 N Rasa3 n/a
8 TRCN0000034357 CGCTTCCAAGATGACTTGGAT pLKO.1 1511 CDS 100% 0.300 0.210 N Rasa3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508734.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07803 pDONR223 100% 83.7% 91.3% None (many diffs) n/a
2 ccsbBroad304_07803 pLX_304 0% 83.7% 91.3% V5 (many diffs) n/a
3 TRCN0000477981 CCTGTTTCCCCCGACCCTGAGTCG pLX_317 14.6% 83.7% 91.3% V5 (many diffs) n/a
Download CSV