Transcript: Mouse XM_006509291.2

PREDICTED: Mus musculus melatonin receptor 1A (Mtnr1a), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mtnr1a (17773)
Length:
2106
CDS:
63..938

Additional Resources:

NCBI RefSeq record:
XM_006509291.2
NBCI Gene record:
Mtnr1a (17773)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026385 CGTGCCTATGATTATTGTCAT pLKO.1 476 CDS 100% 4.950 6.930 N Mtnr1a n/a
2 TRCN0000026399 GCTGACATCTATCCTTAACAA pLKO.1 137 CDS 100% 5.625 4.500 N Mtnr1a n/a
3 TRCN0000026394 GCTGCCTCAACGCAATTATAT pLKO.1 748 CDS 100% 15.000 10.500 N Mtnr1a n/a
4 TRCN0000026365 CCACTCAACCTCATAGGTCTT pLKO.1 642 CDS 100% 4.050 2.835 N Mtnr1a n/a
5 TRCN0000026363 CCCTCTCCACTAATACCCAAT pLKO.1 888 CDS 100% 4.050 2.835 N Mtnr1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01049 pDONR223 100% 68.3% 72% None (many diffs) n/a
2 TRCN0000488582 AACTTAACGGTGGATGGACTATTT pLX_317 29.1% 68.3% 72% V5 (many diffs) n/a
3 TRCN0000492315 AATGGCAGCTTGACTTCAATGCAC pLX_317 39% 68.3% 72% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV