Transcript: Mouse XM_006509489.2

PREDICTED: Mus musculus CDKN2A interacting protein (Cdkn2aip), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdkn2aip (70925)
Length:
4285
CDS:
1085..1444

Additional Resources:

NCBI RefSeq record:
XM_006509489.2
NBCI Gene record:
Cdkn2aip (70925)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509489.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339702 TGAGGTGTAAGTCGGTATATT pLKO_005 2516 3UTR 100% 15.000 21.000 N Cdkn2aip n/a
2 TRCN0000339630 TTGTACTACTACTACCAATTT pLKO_005 3038 3UTR 100% 13.200 18.480 N Cdkn2aip n/a
3 TRCN0000176392 CCAGTGGGTTAACATCTAAAT pLKO.1 1982 3UTR 100% 13.200 9.240 N Cdkn2aip n/a
4 TRCN0000173448 CGAGAGAAGCACTGAAGTTAT pLKO.1 2585 3UTR 100% 13.200 9.240 N Cdkn2aip n/a
5 TRCN0000175188 CTGGACAATAATGGAGATAAT pLKO.1 3856 3UTR 100% 13.200 9.240 N Cdkn2aip n/a
6 TRCN0000339701 GTATGGCTGAAGGCATCAAAG pLKO_005 1368 CDS 100% 10.800 7.560 N Cdkn2aip n/a
7 TRCN0000193729 CGATGTGTAGTTCTGTAGAAT pLKO.1 3007 3UTR 100% 5.625 3.938 N Cdkn2aip n/a
8 TRCN0000193233 CAAGAAAGTATTGTCTGTGAA pLKO.1 2494 3UTR 100% 4.950 3.465 N Cdkn2aip n/a
9 TRCN0000173168 CAGTGAGAGTTCTGTCAAGTT pLKO.1 2250 3UTR 100% 4.950 3.465 N Cdkn2aip n/a
10 TRCN0000339709 CAGTGAGAGTTCTGTCAAGTT pLKO_005 2250 3UTR 100% 4.950 3.465 N Cdkn2aip n/a
11 TRCN0000173519 GCTTGTCGGAAGTTAACCAAT pLKO.1 2272 3UTR 100% 4.950 3.465 N Cdkn2aip n/a
12 TRCN0000339699 GCTTGTCGGAAGTTAACCAAT pLKO_005 2272 3UTR 100% 4.950 3.465 N Cdkn2aip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509489.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12231 pDONR223 100% 18.4% 18.6% None (many diffs) n/a
2 ccsbBroad304_12231 pLX_304 0% 18.4% 18.6% V5 (many diffs) n/a
3 TRCN0000473219 CTCACAAGAGGAACCAGCTTATCC pLX_317 29.8% 18.4% 18.6% V5 (many diffs) n/a
Download CSV