Transcript: Mouse XM_006509680.3

PREDICTED: Mus musculus homer scaffolding protein 3 (Homer3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Homer3 (26558)
Length:
2383
CDS:
92..1192

Additional Resources:

NCBI RefSeq record:
XM_006509680.3
NBCI Gene record:
Homer3 (26558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509680.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106551 CCGAAATGTGTACCGCATCAT pLKO.1 223 CDS 100% 4.950 6.930 N Homer3 n/a
2 TRCN0000106553 GCACGCACTTACCGTGTCCTA pLKO.1 187 CDS 100% 0.880 1.232 N Homer3 n/a
3 TRCN0000351209 GCACGCACTTACCGTGTCCTA pLKO_005 187 CDS 100% 0.880 1.232 N Homer3 n/a
4 TRCN0000311268 CCCAGTTTGCTGAGAAGTTTC pLKO_005 390 CDS 100% 10.800 7.560 N Homer3 n/a
5 TRCN0000305230 CTCTCAGAAGTTCGGGCAATG pLKO_005 310 CDS 100% 6.000 4.200 N Homer3 n/a
6 TRCN0000106550 CGCTTGTTGATCTCTTTCTTT pLKO.1 1879 3UTR 100% 5.625 3.938 N Homer3 n/a
7 TRCN0000106554 GCCACTCAGTGGAGGCAACAA pLKO.1 719 CDS 100% 1.650 1.155 N Homer3 n/a
8 TRCN0000106552 GCTCGAGAGAAATCTCAAGAT pLKO.1 437 CDS 100% 0.000 0.000 N Homer3 n/a
9 TRCN0000334443 GCTCGAGAGAAATCTCAAGAT pLKO_005 437 CDS 100% 0.000 0.000 N Homer3 n/a
10 TRCN0000154879 CCATCATCAACAGCACTGTCA pLKO.1 264 CDS 100% 2.640 1.584 N HOMER3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509680.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07419 pDONR223 100% 80.7% 87.7% None (many diffs) n/a
2 ccsbBroad304_07419 pLX_304 0% 80.7% 87.7% V5 (many diffs) n/a
3 TRCN0000466726 TAACCCTGGTTTCTATGGAAATCC pLX_317 35% 80.7% 87.7% V5 (many diffs) n/a
4 TRCN0000488613 GGCTTTGTTGAGCTCAAATGATTG pLX_317 34.8% 80.7% 87.7% V5 (many diffs) n/a
5 TRCN0000488500 TGGACTCCAATTTAGTCCCTGTTC pLX_317 24.9% 80.7% 87.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV