Transcript: Mouse XM_006509950.3

PREDICTED: Mus musculus adaptor protein complex AP-1, mu 2 subunit (Ap1m2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ap1m2 (11768)
Length:
2485
CDS:
102..1268

Additional Resources:

NCBI RefSeq record:
XM_006509950.3
NBCI Gene record:
Ap1m2 (11768)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509950.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381642 ACCACGCTGAAGAACGCTAAT pLKO_005 309 CDS 100% 10.800 15.120 N Ap1m2 n/a
2 TRCN0000380908 CTTTGTGTCCCACCCTAATTT pLKO_005 1448 3UTR 100% 15.000 12.000 N Ap1m2 n/a
3 TRCN0000111583 CGAGTCAGTCATTGAGAAATT pLKO.1 833 CDS 100% 13.200 10.560 N Ap1m2 n/a
4 TRCN0000111581 GCCTCTGATTAGCCGAAACTA pLKO.1 143 CDS 100% 5.625 4.500 N Ap1m2 n/a
5 TRCN0000379774 AGGGTTAGGGCACTGACTTAA pLKO_005 1368 3UTR 100% 13.200 9.240 N Ap1m2 n/a
6 TRCN0000381100 TGCACTTCCTGTGGATCAAAC pLKO_005 265 CDS 100% 10.800 7.560 N Ap1m2 n/a
7 TRCN0000111584 CCAGGTCCGTTACATGAAGAT pLKO.1 1166 CDS 100% 4.950 3.465 N Ap1m2 n/a
8 TRCN0000111582 GCCTGAGAAGAATGTTGTCAT pLKO.1 1001 CDS 100% 4.950 3.465 N Ap1m2 n/a
9 TRCN0000145247 GAGGTCTTCATTGATGTCATA pLKO.1 504 CDS 100% 4.950 3.960 N AP1M2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509950.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15690 pDONR223 0% 79.7% 88.8% None (many diffs) n/a
2 ccsbBroad304_15690 pLX_304 0% 79.7% 88.8% V5 (many diffs) n/a
3 TRCN0000466644 ACGGATCAATCGAGATTTTAAATA pLX_317 29.7% 79.6% 88.4% V5 (many diffs) n/a
4 ccsbBroadEn_15691 pDONR223 0% 79.7% 88.8% None (many diffs) n/a
5 ccsbBroad304_15691 pLX_304 0% 79.7% 88.8% V5 (many diffs) n/a
6 ccsbBroadEn_11451 pDONR223 100% 79.3% 88% None (many diffs) n/a
7 ccsbBroad304_11451 pLX_304 0% 79.3% 88% V5 (many diffs) n/a
8 TRCN0000481528 GATAGCTTACGACTACCTGCTATG pLX_317 33.2% 79.3% 88% V5 (many diffs) n/a
Download CSV