Transcript: Mouse XM_006510895.4

PREDICTED: Mus musculus synaptosomal-associated protein 91 (Snap91), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Snap91 (20616)
Length:
4360
CDS:
243..2942

Additional Resources:

NCBI RefSeq record:
XM_006510895.4
NBCI Gene record:
Snap91 (20616)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510895.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113155 CGTAGCGTATTCGGGTTCTTT pLKO.1 3152 3UTR 100% 5.625 7.875 N Snap91 n/a
2 TRCN0000113156 GCCAGTTTAGTAGGCAATCTT pLKO.1 2514 CDS 100% 5.625 7.875 N Snap91 n/a
3 TRCN0000113157 GCACCGATTTCAGACCCATTT pLKO.1 1422 CDS 100% 10.800 8.640 N Snap91 n/a
4 TRCN0000151943 CGGATCTTAACATCAAGGATT pLKO.1 2914 CDS 100% 4.950 3.960 N SNAP91 n/a
5 TRCN0000113159 CCACAACTGTTACATCTCCTA pLKO.1 1159 CDS 100% 2.640 1.848 N Snap91 n/a
6 TRCN0000113158 GCTCAGAATAACCTGCTGCAA pLKO.1 2292 CDS 100% 2.640 1.848 N Snap91 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510895.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11428 pDONR223 100% 59% 62.4% None (many diffs) n/a
2 ccsbBroad304_11428 pLX_304 0% 59% 62.4% V5 (many diffs) n/a
3 TRCN0000473453 GGCGATTGTAATACATTATATCAC pLX_317 25% 59% 62.4% V5 (many diffs) n/a
Download CSV