Transcript: Mouse XM_006511014.1

PREDICTED: Mus musculus SUMO/sentrin specific peptidase 6 (Senp6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Senp6 (215351)
Length:
4707
CDS:
689..3787

Additional Resources:

NCBI RefSeq record:
XM_006511014.1
NBCI Gene record:
Senp6 (215351)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031019 CCCTTAATGAAGCTGCACATT pLKO.1 2724 CDS 100% 4.950 3.960 N Senp6 n/a
2 TRCN0000031023 CCAGGCAATACCAGCAGTTTA pLKO.1 1969 CDS 100% 13.200 9.240 N Senp6 n/a
3 TRCN0000425745 CATCTGTGAACACGGGCTTTC pLKO_005 4567 3UTR 100% 6.000 4.200 N RSPH6A n/a
4 TRCN0000031022 GCCAAAGTTGTGGTATTGTTT pLKO.1 1116 CDS 100% 5.625 3.938 N Senp6 n/a
5 TRCN0000031020 CCTGTGATGATAGCAGACATA pLKO.1 1317 CDS 100% 4.950 3.465 N Senp6 n/a
6 TRCN0000031021 GCTCCCTATGAATTTGATGAA pLKO.1 3595 CDS 100% 4.950 3.465 N Senp6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07981 pDONR223 100% 73% 70.1% None (many diffs) n/a
2 ccsbBroad304_07981 pLX_304 0% 73% 70.1% V5 (many diffs) n/a
3 TRCN0000481041 CCACACCTATCACGACGTGAGGGG pLX_317 11.9% 73% 70.1% V5 (many diffs) n/a
Download CSV