Transcript: Mouse XM_006511184.3

PREDICTED: Mus musculus ataxia telangiectasia and Rad3 related (Atr), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atr (245000)
Length:
9629
CDS:
129..8036

Additional Resources:

NCBI RefSeq record:
XM_006511184.3
NBCI Gene record:
Atr (245000)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511184.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023910 GCAGTTATTCCACTGAATGAT pLKO.1 7197 CDS 100% 5.625 3.938 N Atr n/a
2 TRCN0000023913 CATTCCCTGATCCTACATCAT pLKO.1 7429 CDS 100% 4.950 3.465 N Atr n/a
3 TRCN0000023912 GATTATTGAATGGGTGAACAA pLKO.1 7226 CDS 100% 4.950 3.465 N Atr n/a
4 TRCN0000023909 GCTACTAGAATTATGCAACAA pLKO.1 6773 CDS 100% 4.950 3.465 N Atr n/a
5 TRCN0000010300 GAAAGAGGCTCCTACCAACGA pLKO.1 5628 CDS 100% 2.640 1.848 N ATR n/a
6 TRCN0000023911 CGATGGAAGCAATTCCACATT pLKO.1 6800 CDS 100% 0.495 0.347 N Atr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511184.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15334 pDONR223 100% 13% 13.6% None (many diffs) n/a
2 ccsbBroad304_15334 pLX_304 0% 13% 13.6% V5 (many diffs) n/a
3 TRCN0000470985 TCTAATACTCGTCGAGCTACCTAT pLX_317 34.4% 13% 13.6% V5 (many diffs) n/a
Download CSV