Transcript: Mouse XM_006511334.3

PREDICTED: Mus musculus calsyntenin 2 (Clstn2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clstn2 (64085)
Length:
13440
CDS:
413..3295

Additional Resources:

NCBI RefSeq record:
XM_006511334.3
NBCI Gene record:
Clstn2 (64085)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511334.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094737 CTATATCAACTCCCGGCAATT pLKO.1 2176 CDS 100% 10.800 15.120 N Clstn2 n/a
2 TRCN0000094734 CGCATTATGTTGCCGGTCAAT pLKO.1 13015 3UTR 100% 4.950 6.930 N Clstn2 n/a
3 TRCN0000094735 CGGAGTCATAACTGAGAACAA pLKO.1 565 CDS 100% 4.950 6.930 N Clstn2 n/a
4 TRCN0000094736 CCAGAAAGTCTCCTATATCAA pLKO.1 2164 CDS 100% 5.625 3.938 N Clstn2 n/a
5 TRCN0000094738 GTCAACCCTATGGAGAAACAT pLKO.1 3077 CDS 100% 5.625 3.938 N Clstn2 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3893 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511334.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12444 pDONR223 100% 88.9% 94.1% None (many diffs) n/a
2 ccsbBroad304_12444 pLX_304 0% 88.9% 94.1% V5 (many diffs) n/a
3 TRCN0000481401 TAGTCACCGCCTACTTCAGGTGGC pLX_317 14.7% 88.9% 94.1% V5 (many diffs) n/a
Download CSV