Transcript: Mouse XM_006511336.1

PREDICTED: Mus musculus snurportin 1 (Snupn), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snupn (66069)
Length:
1242
CDS:
149..1009

Additional Resources:

NCBI RefSeq record:
XM_006511336.1
NBCI Gene record:
Snupn (66069)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511336.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198358 GATAGCCATTAGTGACCTTAT pLKO.1 1050 3UTR 100% 10.800 15.120 N Snupn n/a
2 TRCN0000182386 GAGGACAGTGATGATAGCCAT pLKO.1 1038 3UTR 100% 2.640 2.112 N Snupn n/a
3 TRCN0000181573 GCTCCAACAGATTATTGAGCA pLKO.1 853 CDS 100% 2.640 2.112 N Snupn n/a
4 TRCN0000296180 ATGCTTTCTGAGTGGTTAATT pLKO_005 242 CDS 100% 15.000 10.500 N SNUPN n/a
5 TRCN0000198359 GCTTTCTGAGTGGTTAATTGA pLKO.1 244 CDS 100% 5.625 3.938 N Snupn n/a
6 TRCN0000181283 CCCTAGCAAGAAGTTACCAAA pLKO.1 202 CDS 100% 4.950 3.465 N Snupn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511336.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02304 pDONR223 100% 70.6% 72.6% None (many diffs) n/a
2 ccsbBroad304_02304 pLX_304 0% 70.6% 72.6% V5 (many diffs) n/a
3 TRCN0000474119 GTCGATAACATGGTTGCAACCATG pLX_317 37.9% 70.6% 72.6% V5 (many diffs) n/a
Download CSV