Transcript: Mouse XM_006511573.3

PREDICTED: Mus musculus interactor of little elongation complex ELL subunit 2 (Ice2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ice2 (93697)
Length:
4582
CDS:
707..3673

Additional Resources:

NCBI RefSeq record:
XM_006511573.3
NBCI Gene record:
Ice2 (93697)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511573.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313382 AGTTACTAGAACGGCATATAA pLKO_005 3364 CDS 100% 15.000 21.000 N Ice2 n/a
2 TRCN0000125808 GCTACACCTAACATTACTGAT pLKO.1 2117 CDS 100% 4.950 6.930 N Ice2 n/a
3 TRCN0000312348 GCTACACCTAACATTACTGAT pLKO_005 2117 CDS 100% 4.950 6.930 N Ice2 n/a
4 TRCN0000125805 GCAGAGAACTTATGTGGATTT pLKO.1 1006 CDS 100% 10.800 8.640 N Ice2 n/a
5 TRCN0000312347 GCAGAGAACTTATGTGGATTT pLKO_005 1006 CDS 100% 10.800 8.640 N Ice2 n/a
6 TRCN0000125804 CCCAGTTATAACAGTGTTTAA pLKO.1 3707 3UTR 100% 13.200 9.240 N Ice2 n/a
7 TRCN0000312349 CCCAGTTATAACAGTGTTTAA pLKO_005 3707 3UTR 100% 13.200 9.240 N Ice2 n/a
8 TRCN0000313381 TTACCTGTTACCATATCATAT pLKO_005 3460 CDS 100% 13.200 9.240 N Ice2 n/a
9 TRCN0000125806 CCCAGTTACCTGTTACCATAT pLKO.1 3455 CDS 100% 10.800 7.560 N Ice2 n/a
10 TRCN0000150652 GCTTGCATTGAACAAGTGAAA pLKO.1 1235 CDS 100% 4.950 3.465 N ICE2 n/a
11 TRCN0000125807 CCTCTGCATTTCAGAAGCCTA pLKO.1 2817 CDS 100% 2.640 1.848 N Ice2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511573.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12587 pDONR223 100% 28.9% 29.1% None (many diffs) n/a
2 TRCN0000468764 ATAATGACACAGGATGTCATCAAC pLX_317 41% 28.9% 29.1% V5 (many diffs) n/a
Download CSV