Construct: ORF TRCN0000468764
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017002.1_s317c1
- Derived from:
- ccsbBroadEn_12587
- DNA Barcode:
- ATAATGACACAGGATGTCATCAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ICE2 (79664)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468764
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79664 | ICE2 | interactor of little elonga... | NM_001018089.3 | 39.2% | 39.2% | 1_1539del;1932T>C |
| 2 | human | 79664 | ICE2 | interactor of little elonga... | XM_005254662.2 | 39.2% | 39.2% | 1_1539del;1932T>C |
| 3 | human | 79664 | ICE2 | interactor of little elonga... | XM_011522010.2 | 39.2% | 39.2% | 1_1539del;1932T>C |
| 4 | human | 79664 | ICE2 | interactor of little elonga... | XM_011522011.2 | 39.2% | 39.2% | 1_1539del;1932T>C |
| 5 | human | 79664 | ICE2 | interactor of little elonga... | XM_024450051.1 | 39.2% | 39.2% | 1_1539del;1932T>C |
| 6 | human | 79664 | ICE2 | interactor of little elonga... | NM_024611.6 | 33.7% | 33.8% | 1_1950del;2343T>C |
| 7 | human | 79664 | ICE2 | interactor of little elonga... | XM_005254661.2 | 33.7% | 33.8% | 1_1950del;2343T>C |
| 8 | human | 79664 | ICE2 | interactor of little elonga... | XM_011522009.2 | 33.7% | 33.8% | 1_1950del;2343T>C |
| 9 | human | 79664 | ICE2 | interactor of little elonga... | XM_017022569.2 | 33.7% | 33.8% | 1_1950del;2343T>C |
| 10 | human | 79664 | ICE2 | interactor of little elonga... | XR_931903.3 | 30.2% | (many diffs) | |
| 11 | human | 79664 | ICE2 | interactor of little elonga... | XR_931902.3 | 25.8% | (many diffs) | |
| 12 | human | 79664 | ICE2 | interactor of little elonga... | XR_001751386.2 | 25.5% | (many diffs) | |
| 13 | human | 79664 | ICE2 | interactor of little elonga... | NR_147171.2 | 13.9% | (many diffs) | |
| 14 | mouse | 93697 | Ice2 | interactor of little elonga... | XM_006511575.3 | 33.3% | 33.6% | (many diffs) |
| 15 | mouse | 93697 | Ice2 | interactor of little elonga... | XM_006511574.3 | 29.9% | 30.2% | (many diffs) |
| 16 | mouse | 93697 | Ice2 | interactor of little elonga... | NM_145618.3 | 28.9% | 29.1% | (many diffs) |
| 17 | mouse | 93697 | Ice2 | interactor of little elonga... | XM_006511573.3 | 28.9% | 29.1% | (many diffs) |
| 18 | mouse | 93697 | Ice2 | interactor of little elonga... | XR_379471.3 | 16.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1062
- ORF length:
- 996
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca ggatgagctc ttaaagccaa tttccagaaa agtaccagaa ttgcccttaa 121 tgaatttaga aaattctaaa cagccttctg tttctgagca attgtctggt ccttcagact 181 cctctagttg gccgaaatct ggatggcctt ctgcatttca gaagccaaaa ggacgattgc 241 catatgaact tcaggactat gttgaagata catcggaata cctagctcct caggaaggaa 301 attttgttta taagttattt agcctgcaag acctgttgtt actcgtacgc tgcagtgtcc 361 agaggataga gacaagacca cgttctaaaa aacggaagaa aatcagaaga caatttccag 421 tttatgtact accaaaagta gagtatcaag cttgttacgg agttgaagct ctgactgaaa 481 gtgaactttg tcgcttatgg actgaaagtt tattgcattc caacagctca ttttatgttg 541 ggcatatcga tgcatttact tcaaaacttt ttctactgga agaaattacc tcagaagaat 601 taaaagaaaa gctttcagca ctcaagattt ccaatttatt taacatcctc caacaCATTC 661 TAAAGAAACT AAGTAGCTTG CAGGAGGGTT CCTACTTGTT ATCTCATGCA GCAGAAGATT 721 CTTCACTCCT GATTTATAAG GCCTCTGATG GAAAAGTTAC TAGGACAGCA TACAATTTGT 781 ATAAAACACA TTGCGGCCTT CCTGGTGTAC CTTCCAGTCT CTCAGTTCCC TGGGTCCCAT 841 TAGATCCCAG CCTGTTATTA CCATATCATA TCCATCATGG AAGAATACCT TGTACTTTTC 901 CACCGAAATC ACTGGATACC ACAACACAAC AAAAGATTGG TGGAACGAGA ATGCCTACAC 961 GCAGCCACAG GAATCCAGTT TCCATGGAAA CCAAAAGCAG TTGCTTGCCT GCTCAGCAAG 1021 TTGAAACTGA AGGAGTGGCT CCACATAAAA GAAAAATAAC TTGCCCAACT TTCTTGTACA 1081 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1141 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1201 AGGACGAATA ATGACACAGG ATGTCATCAA CACGCGTTAA GTCgacaatc aacctctgga 1261 ttacaaaatt tgtgaaagat t