Transcript: Mouse XM_006511853.2

PREDICTED: Mus musculus inositol hexaphosphate kinase 2 (Ip6k2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ip6k2 (76500)
Length:
1403
CDS:
238..1308

Additional Resources:

NCBI RefSeq record:
XM_006511853.2
NBCI Gene record:
Ip6k2 (76500)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511853.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202175 CAATGAGACAACCCTGTGCAA pLKO.1 342 CDS 100% 2.640 1.848 N Ip6k2 n/a
2 TRCN0000202065 CCGATTCAATGAGACAACCCT pLKO.1 336 CDS 100% 0.750 0.525 N Ip6k2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511853.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15841 pDONR223 0% 24.4% 21% None (many diffs) n/a
2 ccsbBroad304_15841 pLX_304 0% 24.4% 21% V5 (many diffs) n/a
3 TRCN0000465932 GCCTATCAGACCGAAGTTGTCGTT pLX_317 100% 24% 4.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15842 pDONR223 0% 18% 17.9% None (many diffs) n/a
5 ccsbBroad304_15842 pLX_304 0% 18% 17.9% V5 (many diffs) n/a
6 TRCN0000492194 ATCCTCCCCCCGGAGATAATCTAT pLX_317 100% 18% 17.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV