Transcript: Mouse XM_006511872.2

PREDICTED: Mus musculus RNA binding motif protein 5 (Rbm5), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbm5 (83486)
Length:
3011
CDS:
92..2539

Additional Resources:

NCBI RefSeq record:
XM_006511872.2
NBCI Gene record:
Rbm5 (83486)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511872.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054663 CGAGAGCGATATTCGAGAAAT pLKO.1 421 CDS 100% 13.200 18.480 N Rbm5 n/a
2 TRCN0000287632 CGAGAGCGATATTCGAGAAAT pLKO_005 421 CDS 100% 13.200 18.480 N Rbm5 n/a
3 TRCN0000054667 CGGTCTGAAGATGGCTATCAT pLKO.1 302 CDS 100% 5.625 4.500 N Rbm5 n/a
4 TRCN0000295102 CTAAGGTGTATATAGTGTAAA pLKO_005 2756 3UTR 100% 13.200 9.240 N Rbm5 n/a
5 TRCN0000295101 TGAGGCTCAAGTCCGACTAAA pLKO_005 2410 CDS 100% 13.200 9.240 N Rbm5 n/a
6 TRCN0000369392 TGACCGTGATGAGCGTGAATC pLKO_005 160 CDS 100% 10.800 7.560 N RBM5 n/a
7 TRCN0000054665 CCACAGTAACATTGGCAACAA pLKO.1 2317 CDS 100% 4.950 3.465 N Rbm5 n/a
8 TRCN0000287688 CCACAGTAACATTGGCAACAA pLKO_005 2317 CDS 100% 4.950 3.465 N Rbm5 n/a
9 TRCN0000074876 GCAGACAAGTTTGACTCTGAA pLKO.1 707 CDS 100% 4.950 3.465 N RBM5 n/a
10 TRCN0000054666 GTCAATAACATTCGCCTCATA pLKO.1 866 CDS 100% 4.950 3.465 N Rbm5 n/a
11 TRCN0000054664 GCAGCAGAAAGACGAGAGAAA pLKO.1 2204 CDS 100% 4.950 2.970 N Rbm5 n/a
12 TRCN0000287687 GCAGCAGAAAGACGAGAGAAA pLKO_005 2204 CDS 100% 4.950 2.970 N Rbm5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511872.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11465 pDONR223 100% 61.7% 65.2% None (many diffs) n/a
2 ccsbBroad304_11465 pLX_304 0% 61.7% 65.2% V5 (many diffs) n/a
3 TRCN0000466364 TTAGGTTTCCAGCGTTGTGTGGTT pLX_317 18.9% 61.7% 65.2% V5 (many diffs) n/a
Download CSV