Transcript: Mouse XM_006512141.3

PREDICTED: Mus musculus kelch-like 18 (Klhl18), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klhl18 (270201)
Length:
4538
CDS:
96..1835

Additional Resources:

NCBI RefSeq record:
XM_006512141.3
NBCI Gene record:
Klhl18 (270201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512141.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108896 TGAGATTGTAATGCAGGGAAT pLKO.1 326 CDS 100% 4.050 3.240 N Klhl18 n/a
2 TRCN0000108897 GATGAAGCAAAGGACTATCAT pLKO.1 867 CDS 100% 5.625 3.938 N Klhl18 n/a
3 TRCN0000108898 GAGGTTACGATGGACAGTCAA pLKO.1 1699 CDS 100% 4.950 3.465 N Klhl18 n/a
4 TRCN0000426646 CAGTCTTTGAGGGCAGGATAT pLKO_005 1387 CDS 100% 10.800 6.480 N KLHL18 n/a
5 TRCN0000108895 CCCAAGAAACAGGAAGGGAAT pLKO.1 2450 3UTR 100% 4.050 2.430 N Klhl18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512141.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11712 pDONR223 100% 79.8% 86.3% None (many diffs) n/a
2 ccsbBroad304_11712 pLX_304 0% 79.8% 86.3% V5 (many diffs) n/a
3 TRCN0000472472 TACTATGTGATGTCTAAATTAGGG pLX_317 33.4% 79.8% 86.3% V5 (many diffs) n/a
Download CSV