Transcript: Mouse XM_006512176.3

PREDICTED: Mus musculus zinc finger with KRAB and SCAN domains 7 (Zkscan7), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zkscan7 (382118)
Length:
7356
CDS:
206..3202

Additional Resources:

NCBI RefSeq record:
XM_006512176.3
NBCI Gene record:
Zkscan7 (382118)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512176.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239058 TTAGTCAGCGGTCCACCTTTA pLKO_005 2280 CDS 100% 10.800 15.120 N Zkscan7 n/a
2 TRCN0000257046 CAACACCAGAGACTCCGTAAT pLKO_005 1472 CDS 100% 10.800 7.560 N Zkscan7 n/a
3 TRCN0000239060 GACATCTGTAAAGATCCTTTA pLKO_005 1052 CDS 100% 10.800 7.560 N Zkscan7 n/a
4 TRCN0000413960 CACACTGGAGAGAAGCCTTAC pLKO_005 2990 CDS 100% 6.000 3.000 Y Zfp612 n/a
5 TRCN0000088533 CGGGAGGCAGAGGCAGGCAAT pLKO.1 4704 3UTR 100% 0.000 0.000 Y Trrap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512176.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09977 pDONR223 100% 28% 26.3% None (many diffs) n/a
2 ccsbBroad304_09977 pLX_304 0% 28% 26.3% V5 (many diffs) n/a
3 TRCN0000477896 TCCACCTTATGCACCGACGTTCCA pLX_317 45.7% 28% 26.3% V5 (many diffs) n/a
Download CSV